Previous Contig 010260:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009G17Sequence590004780 (4)gb:AY039940_15604516e-56Arabidopsis thaliana putative pre-mRNA splicing factor PRP19 (At1g04510) mRNA, c751010260 (4)gb:AE016959_10230071e-63Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02
JMFF042O05Sequence635004780 (4)pir|C84744|C847443e-61probable PRP19-like spliceosomal protein [imported] - Arabidopsis thaliana>gb:AC611010260 (4)gb:AE016959_10230078e-38Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02
JMSF006C24Sequence377004837 (7)gb:BT001921_16355243e-12Arabidopsis thaliana clone C105451 unknown protein (At3g05545) mRNA, complete cd457010260 (4)gb:AE016959_10230071e-20Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02
JMSF045O21Sequence684004780 (4)pir|C84744|C847443e-69probable PRP19-like spliceosomal protein [imported] - Arabidopsis thaliana>gb:AC652010260 (4)gb:AE016959_10230071e-43Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF009G17+ AACAGGTACATCAGGGTCTATTGTGAAGATTTGGGATGTAAAGAGTC
                      ____________________________________________________________
consensus AACAGGTACATCAGGGTCTATTGTGAAGATTTGGGATGTAAAGAGTC
 
. : . : . : . : . : . :
rJMFF009G17+ AGGCAAATGTTGCACGATTTGATGGGCACATTGGAACTGTTACTGCAATCTCCTTTTCAG
rJMSF045O21+ TTTCAG
                      ____________________________________________________________
consensus AGGCAAATGTTGCACGATTTGATGGGCACATTGGAACTGTTACTGCAATCTCCTTTTCAG
 
. : . : . : . : . : . :
rJMFF009G17+ AAAATGGTTATTTCCTAGCAACTGCTGCTCAAGATGGGGTAAAGCTCTGGGATTTACGCA
rJMSF045O21+ AAAATGGTTATTTCCTAGCAACTGCTGCTCAAGATGGGGTAAAGCTCTGGGATTTACGCA
rJMFF042O05+ GGGATTTACGCA
                      ____________________________________________________________
consensus AAAATGGTTATTTCCTAGCAACTGCTGCTCAAGATGGGGTAAAGCTCTGGGATTTACGCA
 
. : . : . : . : . : . :
rJMFF009G17+ AATTAAGGAA-TTTTAGAACTTTCACGCCATATGATGACAACACACCAACCCAAACAGTG
rJMSF045O21+ AATTAAGGAATTTTTAGAACTTTCACGCCATATGATGACAACACACCAACCCAAACAGTG
rJMFF042O05+ AATTAAGGAA-TTTTAGAACTTTCACGCCATATGATGACAACACACCAACCCAAACAGTG
                      ____________________________________________________________
consensus AATTAAGGAA-TTTTAGAACTTTCACGCCATATGATGACAACACACCAACCCAAACAGTG
 
. : . : . : . : . : . :
rJMFF009G17+ GAATTTGACCAGAGTGGAAGTTACCTTGCCTTGGGAGGATCAGATATAAGAGTCTATCAA
rJMSF006C24+ GGATCAGATATAAGAGTCTATCAA
rJMSF045O21+ GAATTTGACCAGAGTGGAAGTTACCTTGCCTTGGGAGGATCAGATATAAGAGTCTATCAA
rJMFF042O05+ GAATTTGACCAGAGTGGAAGTTACCTTGCCTTGGGAGGATCAGATATAAGAGTCTATCAA
                      ____________________________________________________________
consensus GAATTTGACCAGAGTGGAAGTTACCTTGCCTTGGGAGGATCAGATATAAGAGTCTATCAA
 
. : . : . : . : . : . :
rJMFF009G17+ GTTGCTAGTGTGAAGTCGGAATGGGGCTGCATCAGGACATTCCCTGATTTGTCAGGCACA
rJMSF006C24+ GTTGCTAGTGTGAAGTCGGAATGGGGCTGCATCAGGACATTCCCTGATTTGTCAGGCACA
rJMSF045O21+ GTTGCTAGTGTGAAGTCGGAATGGGGCTGCATCAGGACATTCCCTGATTTGTCAGGCACA
rJMFF042O05+ GTTGCTAGTGTGAAGTCGGAATGGGGCTGCATCAGGACATTCCCTGATTTGTCAGGCACA
                      ____________________________________________________________
consensus GTTGCTAGTGTGAAGTCGGAATGGGGCTGCATCAGGACATTCCCTGATTTGTCAGGCACA
 
. : . : . : . : . : . :
rJMFF009G17+ GGCAAAGCCACATGTCTAAAATTTGGTCCAGATGCTAAATACATAGCTGTTGGATCAATG
rJMSF006C24+ GGCAAAGCCACATGTCTAAAATTTGGTCCAGATGCTAAATACATAGCTGTTGGATCAATG
rJMSF045O21+ GGCAAAGCCACATGTCTAAAATTTGGTCCAGATGCTAAATACATAGCTGTTGGATCAATG
rJMFF042O05+ GGCAAAGCCACATGTCTAAAATTTGGTCCAGATGCTAAATACATAGCTGTTGGATCAATG
                      ____________________________________________________________
consensus GGCAAAGCCACATGTCTAAAATTTGGTCCAGATGCTAAATACATAGCTGTTGGATCAATG
 
. : . : . : . : . : . :
rJMFF009G17+ GATCGAAACCTCAGAATATTTGGGCTGCCACAGGAGGATGGTCAACCAGAAGATTAATTG
rJMSF006C24+ GATCGAAACCTCAGAATANTTGGGCTGCCACAGGAGGATGGTCAACCAGAAGATTAATTG
rJMSF045O21+ GATCGAAACCTCAGAATATTTGGGCTGCCACAGGAGGATGGTCAACCAGAAGATTAATTG
rJMFF042O05+ GATCGAAACCTCAGAATATTTGGGCTGCCACAGGAGGATGGTCAACCAGAAGATTAATTG
                      ____________________________________________________________
consensus GATCGAAACCTCAGAATATTTGGGCTGCCACAGGAGGATGGTCAACCAGAAGATTAATTG
 
. : . : . : . : . : . :
rJMFF009G17+ CCATTTCACTGTGTTGACACTAATGGTACTTCTATAGCATATGCTTCCTGGTTGCAGGTT
rJMSF006C24+ CCATTTCACTGTGTTGACACTAATGGTACTTCTATAGCATATGCTTCCTGGTTGCAGGTT
rJMSF045O21+ CCATTTCACTGTGTTGACACTAATGGTACTTCTATAGCATATGCTTCCTGGTTGCAGGTT
rJMFF042O05+ CCATTTCACTGTGTTGACACTAATGGTACTTCTATAGCATATGCTTCCTGGTTGCAGGTT
                      ____________________________________________________________
consensus CCATTTCACTGTGTTGACACTAATGGTACTTCTATAGCATATGCTTCCTGGTTGCAGGTT
 
. : . : . : . : . : . :
rJMFF009G17+ TTGGCGCTTATTTTGGGCAGAAGAATTTGTGAATGACTATCTTTTGAATTTGCCCAAAGC
rJMSF006C24+ TTGGCGCTTATTTTGGGCAGAAGAATTTGTGAATGACTATCTTTTGAATTTGCCCAAAGC
rJMSF045O21+ TTGGCGCTTATTTTGGGCAGAAGAATTTGTGAATGACTATCTTTTGAATTTGCCCAAAGC
rJMFF042O05+ TTGGCGCTTATTTTGGGCAGAAGAATTTGTGAATGACTATCTTTTGAATTTGCCCAAAGC
                      ____________________________________________________________
consensus TTGGCGCTTATTTTGGGCAGAAGAATTTGTGAATGACTATCTTTTGAATTTGCCCAAAGC
 
. : . : . : . : . : . :
rJMFF009G17+ GTGGTTCCCTGCCAGATTATTAGTGACAATGCAATAAATCTGAAGCAATTTGCCATCTTA
rJMSF006C24+ GTGGTTCCCTGCCAGANTATTAGTGACAATGCAATAAATCTGAAGCAATTTGCCATCTTN
rJMSF045O21+ GTGGTTCCCTGCCAGATTATTAGTGACAATGCAATAAATCTGAAGCAATTTGCCATCTTA
rJMFF042O05+ GTGGTTCCCTGCCAGATTATTAGTGACAATGCAATAAATCTGAAGCAATTTGCCATCTTA
                      ____________________________________________________________
consensus GTGGTTCCCTGCCAGATTATTAGTGACAATGCAATAAATCTGAAGCAATTTGCCATCTTA
 
. : . : . : . : . : . :
rJMFF009G17+ TCCACTTTGAGGGTTAATTTATCGTGTAACAAATTTTTTTTGGGGTAATATTATTGTATC
rJMSF006C24+ TCCACTCNGAGGGTTAATTTATCGTGTAACAAA-NTTTTTTGGGGTAATATTATTGTATC
rJMSF045O21+ TCCACTTTGAGGGTTAATTTATCGTGTAACAAA-TTTTTTTGGGGTAATATTATTGTATC
rJMFF042O05+ TCCACTTTGAGGGTTAATTTATCGTGTAACAAATTTTTTTTGGGGTAATATTATTGTATC
                      ____________________________________________________________
consensus TCCACTTTGAGGGTTAATTTATCGTGTAACAAATTTTTTTTGGGGTAATATTATTGTATC
 
. : . : . : . : . : . :
rJMFF009G17+ ATACAAATGTAACAATTGTTTGGAATGGCTGAGAAAAAAAGACTA
rJMSF006C24+ ACACAAATGNAACA
rJMSF045O21+ ATACAAATGTAACAATTGTTTGGAATGGCTGAGAAAAAAAGACTA
rJMFF042O05+ ATACAAATGTAACAATTGTTTGGAATGGCTGAGAAAAAAAGACTATTGAATATTGCTCGG
                      ____________________________________________________________
consensus ATACAAATGTAACAATTGTTTGGAATGGCTGAGAAAAAAAGACTATTGAATATTGCTCGG