Previous Contig 010259:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002P01Sequence598010259 (4)gb:AY578727_16159972e-10Vernicia fordii cytochrome b5 isoform Cb5-A mRNA, complete cds.
JMFF042N20Sequence615010259 (4)gb:AY578727_16159975e-37Vernicia fordii cytochrome b5 isoform Cb5-A mRNA, complete cds.609010259 (4)
JMFS152C03Sequence627010259 (4)gb:AY578727_16159975e-37Vernicia fordii cytochrome b5 isoform Cb5-A mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS152C03- GAGTTTTAGCGAATTCTGTTGCCTTTCCTGCGAGCGAGAGCC
JMFF042N20- AGAGCC
                      ____________________________________________________________
consensus GAGTTTTAGCGAATTCTGTTGCCTTTCCTGCGAGCGAGAGCC
 
. : . : . : . : . : . :
JMFS152C03- AGAGCCCCATTCCCGTCTCTTCAA----AAGATGAGTTCCGACGCCAAAGTTCATTCCTT
JMFF042N20- AGAGCCCCATTCCCGTCTCTTCAAGTTGAAGATGAGTTCCGACGCCAAAGTTCATTCCTT
                      ____________________________________________________________
consensus AGAGCCCCATTCCCGTCTCTTCAAGTTGAAGATGAGTTCCGACGCCAAAGTTCATTCCTT
 
. : . : . : . : . : . :
JMFS152C03- TGAGGAGGTTTCTAAGCACAATAAGAAAGATGATTGCTGGATTATAATCTCTGGAAAGGT
JMFF042N20- TGAGGAGGTTTCTAAGCACAATAAGAAAGATGATTGCTGGATTATAATCTCTGGAAAGGT
                      ____________________________________________________________
consensus TGAGGAGGTTTCTAAGCACAATAAGAAAGATGATTGCTGGATTATAATCTCTGGAAAGGT
 
. : . : . : . : . : . :
JMFS152C03- GTACAATGTAACTCCATATCTGGATGATCATCCTGGAGGTGACGATGTCCTCCTAACTGC
JMFF042N20- GTACAATGTAACTCCATATCTGGATGATCATCCTGGAGGTGACGATGTCCTCCTAACTGC
                      ____________________________________________________________
consensus GTACAATGTAACTCCATATCTGGATGATCATCCTGGAGGTGACGATGTCCTCCTAACTGC
 
. : . : . : . : . : . :
JMFS152C03- AACGGGAAAGGATGCAACCAATGACTTTGAAGATATTGGGCACAGCGATGATGCGAGAGA
JMFF042N20- AACGGGAAAGGATGCAACCAATGACTTTGAAGATATTGGGCACAGCGATGATGCGAGAGA
rJMFF002P01+ CGGGAAAGGATGCAACCAATGNCTCTGAAGATATTGGGCACAGCGATGATGCGAGAGA
                      ____________________________________________________________
consensus AACGGGAAAGGATGCAACCAATGACTTTGAAGATATTGGGCACAGCGATGATGCGAGAGA
 
. : . : . : . : . : . :
JMFS152C03- GACGATGAAGAAATACTATATTGGTGATATTGACAGCAACACTGTGCCGGAGAAACCCAT
JMFF042N20- GACGATGAAGAAATACTATATTGGTGATATTGACAGCAACACTGTGCCGGAGAAACCCAT
rJMFF002P01+ GNCGATGAAGAAATNCTATATTGGTGATATTGACAGCAACACTGTGCCGGAGAAACCCAT
rJMFF042N20+ GAAACCCAT
                      ____________________________________________________________
consensus GACGATGAAGAAATACTATATTGGTGATATTGACAGCAACACTGTGCCGGAGAAACCCAT
 
. : . : . : . : . : . :
JMFS152C03- ATACACTCCACCTCCGACATCCTCTGCACCCAAGCAAAAATCGGGAGGTATGATGACACT
JMFF042N20- ATACACTCCACCTCCGACATCCTCTGCACCCAAGCAAAAATCGGGAGGTATGATGACACT
rJMFF002P01+ ATACACTCCACCTCCGACATCCTCTGCACCCAAGCAAAAATCGGGAGGTATGATGACACT
rJMFF042N20+ ATACACTTCACCTCCGACATCCTTTGCACCCAAGCAAAAATCGGGAGGTATGATGACACT
                      ____________________________________________________________
consensus ATACACTCCACCTCCGACATCCTCTGCACCCAAGCAAAAATCGGGAGGTATGATGACACT
 
. : . : . : . : . : . :
JMFS152C03- ATTGCAATTCTTGCTGCCTTTACTGATATTGGGGTTTGCGGTTGGATTCCGGTACTTCAA
JMFF042N20- ATTGCAATTCTTGCTGCCTTTACTGATATTGGGGTTTGCGGTTGGATTCCGGTACTTCAA
rJMFF002P01+ ATTGCAATTCTTGCTGCCTTTACTGATATTGGGGTTTGCGGTTGGATTCCGGTACTTCAA
rJMFF042N20+ ATTGCAATTCTTGCTGCCTTTACTGATATTGGGGTTTGCGGTTGGATTCCGGTACTTCAA
                      ____________________________________________________________
consensus ATTGCAATTCTTGCTGCCTTTACTGATATTGGGGTTTGCGGTTGGATTCCGGTACTTCAA
 
. : . : . : . : . : . :
JMFS152C03- CAAGAAGGAATAGAGACGACGATGACGATGATGATGTGGCGATATGTTAGTGTTTTCTCA
JMFF042N20- CAAGAAGGAATAGAGACGACGATGACGATGATGATGTGGCGATATGTTAGTGTTTTCTCA
rJMFF002P01+ CAAGAAGGAATAGAGACGACGATGACGATGATGATGTGGCGATATGTTAGTGTTTTCTCA
rJMFF042N20+ CAAGAAGGAATAGAGACGACGATGACGATGATGATGTGGCGATATGTTAGTGTTTTCTCA
                      ____________________________________________________________
consensus CAAGAAGGAATAGAGACGACGATGACGATGATGATGTGGCGATATGTTAGTGTTTTCTCA
 
. : . : . : . : . : . :
JMFS152C03- TTAGTTTATGTGTCAAAGTGAAGTAAACTAAAATTTCCTAGTGTTGGTAAGAGGGAATAA
JMFF042N20- TTAGTTTATGTGTCAAAGTGAAGTANACTAAAATTTCCTAGTGTTGGTAAGAGGGAATAA
rJMFF002P01+ TTAGTTTATGTGTCAAAGTGAAGTAAACTAAAATTTCCTAGTGTTGGTAAGAGGGAATAA
rJMFF042N20+ TTAGTTTATGTGTCAAAGTGAAGTAAACTAAAATTTCCTAGTGTTGGTAAGAGGGAATAA
                      ____________________________________________________________
consensus TTAGTTTATGTGTCAAAGTGAAGTAAACTAAAATTTCCTAGTGTTGGTAAGAGGGAATAA
 
. : . : . : . : . : . :
JMFS152C03- AAATGGGGTTTGCCAATAAGGTTAGATTTTGGTAAGTGGTATTATTGGA
JMFF042N20- AAATGGGGTTTGCCAATAAGGTTAGATTTTGGTAAGTGGTATTATTGGAGTAGTTGTCTA
rJMFF002P01+ AAATGGGGTTTGCCAATAAGGTTAGATTTTGGTAAGTGGTATTATTGGAGTAGTTGTCTA
rJMFF042N20+ AAATGGGGTTTGCCAATAAGGTTAGATTTTGGTAAGTGGTATTATTGGAGTAGTTGTCTA
                      ____________________________________________________________
consensus AAATGGGGTTTGCCAATAAGGTTAGATTTTGGTAAGTGGTATTATTGGAGTAGTTGTCTA
 
. : . : . : . : . : . :
JMFF042N20- ATTGTTTTG
rJMFF002P01+ ATTGTTTTGTGTTTAGACTTTAGAGGGAAGAAAAATAAGGTTTGCCATTTATGTTTTATT
rJMFF042N20+ ATTGTTTTGTGTTTAGACTTTAGAGGGAAGAAAAATAAGGTTTGCCATTTATGTTTTATT
                      ____________________________________________________________
consensus ATTGTTTTGTGTTTAGACTTTAGAGGGAAGAAAAATAAGGTTTGCCATTTATGTTTTATT
 
. : . : . : . : . : . :
rJMFF002P01+ GTGTTGTTACATTATTGCAATCCCTAAATATGCAGGTGTTCTAGTCCCTTATTTAAGCCT
rJMFF042N20+ GTGTTGTTACATTATTGCAATCCCTAAATATGCAGGTGTTCTAGTCCCTTATTTAAGCCT
                      ____________________________________________________________
consensus GTGTTGTTACATTATTGCAATCCCTAAATATGCAGGTGTTCTAGTCCCTTATTTAAGCCT
 
. : . : . : . : . : . :
rJMFF002P01+ TAGATTCTTGTTGGTGATATTGCTGCTGCTTTTGGGCCCTTAGCCAATAATGTCCAAT
rJMFF042N20+ TAGATTCTTGTTGGTGATATTGCTGCTGCTTTTGGGCCTTTAGCCAATAATGTCCAATAC
                      ____________________________________________________________
consensus TAGATTCTTGTTGGTGATATTGCTGCTGCTTTTGGGCCTTTAGCCAATAATGTCCAATAC
 
. : . : . : . : . : . :
rJMFF042N20+ TTTAAGACACTTTTCTTTACATGTCTCAGACCTTGTGGCCAAATTATATAGTCCACGCTG
                      ____________________________________________________________
consensus TTTAAGACACTTTTCTTTACATGTCTCAGACCTTGTGGCCAAATTATATAGTCCACGCTG
 
. : . : . : . : . : . :
rJMFF042N20+ CATCGGGGATCTTGATTCAAAACGACATTCATATTATGTACGTGTAGGTTCATTTGTAGT
                      ____________________________________________________________
consensus CATCGGGGATCTTGATTCAAAACGACATTCATATTATGTACGTGTAGGTTCATTTGTAGT