Previous Contig 010256:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007A11Sequence581007362 (13)gb:AF384037_17941466e-60Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.785010256 (15)gb:AC005917_15331964e-81Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.
JMFF016M02Sequence623007362 (13)gb:AF384037_17941463e-67Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.798010256 (15)gb:AC005917_15331968e-72Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.
JMFF024C16Sequence516007362 (13)gb:AF384037_17941461e-43Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.775010256 (15)gb:AC005917_15331962e-86Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.
JMFF025N12Sequence817010256 (15)gb:AC005917_15331968e-75Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.
JMFF027E02Sequence611007362 (13)gb:AF384037_17941468e-67Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.749010256 (15)gb:AC005917_15331963e-75Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.
JMFF032B09Sequence513010256 (15)gb:AC005917_15331969e-69Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.708010256 (15)gb:AF384037_17941465e-55Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.
JMFF041N20Sequence658007362 (13)gb:AF384037_17941466e-69Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.594010256 (15)gb:AF384037_17941462e-49Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.
JMFF042N08Sequence634007362 (13)gb:AF384037_17941462e-56Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.582010256 (15)gb:AP002901_18237353e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045
JMFF042N14Sequence635007362 (13)gb:AF384037_17941463e-61Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.466010256 (15)gb:AP002901_18237352e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045
JMFF049C24Sequence641007362 (13)gb:AF384037_17941461e-51Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.457010256 (15)gb:AC005917_15331961e-24Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.
JMFN039D23Sequence472010256 (15)gb:AP002901_18237353e-30Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045
JMSF035G13Sequence707007362 (13)sp|O22607|MSI4_ARATH2e-83WD-40 repeat protein MSI4.>pir|G84577|G84577 probable WD-40 repeat protein, MSI4779010256 (15)gb:AF384037_17941462e-87Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.
JMSF040K15Sequence617007362 (13)gb:AF384037_17941465e-51Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.860010256 (15)sp|O22607|MSI4_ARATH1e-81WD-40 repeat protein MSI4.>pir|G84577|G84577 probable WD-40 repeat protein, MSI4
JMSF043M18Sequence749007362 (13)gb:AF384037_17941463e-73Zea mays nucleosome/chromatin assembly factor C (nfc102) mRNA, complete cds.741010256 (15)gb:AC005917_15331961e-76Arabidopsis thaliana chromosome 2 clone F3P11 map CIC06E08, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF035G13+ TGTTCAGT
                      ____________________________________________________________
consensus TGTTCAGT
 
. : . : . : . : . : . :
rJMSF035G13+ TCTGCCCATCAAGTTCACAGGAATTCTGTAGTGTTGGTGATGATTCATG-TCTCATTCTA
rJMFF024C16+ TCTGCCCATCAAGTTCACAGGAATTCTGTAGTGTTGGTGATGATTCATG-TCTCATTCTA
rJMSF043M18+ CTA
rJMFF007A11+ TAGTGTTGGTGATGATTCATG-TCTCATTCTA
rJMSF040K15+ TCTGCCCATCAAGTTCACAGGAATTCTGTAGTGTTGGGGATGATTCATGTTCTCATTCTA
                      ____________________________________________________________
consensus TCTGCCCATCAAGTTCACAGGAATTCTGTAGTGTTGGTGATGATTCATG-TCTCATTCTA
 
. : . : . : . : . : . :
rJMSF035G13+ TGGGATGCTCGAGTTGGTACTAGTCCAGTTGTAAAGGTTGAAAAAGCTCATAATGCTGAT
JMFF032B09- AGTTGGTACTAGTCCAGTTGTAAAGGTTGAAAAAGCTCATAATGCTGAT
rJMFF024C16+ TGGGATGCTCGAGTTGGTACTAGTCCAGTTGTAAAGGTTGAAAAAGCTCATAATGCTGAT
rJMFF027E02+ TGGGATGCTCGAGTTCGTACTAGTCCAGTTGTAAAGGTTGAAAAAGCTCATAATGCTGAT
rJMSF043M18+ TGGGATGCTCGAGTTGGTACTAGTCCAGTTGTAAAGGTTGAAAAAGCTCATAATGCTGAT
rJMFF007A11+ TGGGATGCTCGAGTTCGTACTAGTCCAGTTGTAAAGGTTGAAAAAGCTCATAATGCTGAT
rJMSF040K15+ TGGGATGCTCGAGTTGGTACTAGTCCAGTTGTAAAGGTTGAAAAAGCTCATAATGCTGAT
rJMFF016M02+ CTAGTCCAGTNGTAAAGGTTGAAAAAGCTCATAATGCTGAT
rJMFF025N12+ GGGATGCTCGAGTTGGTACTAGTCCAGTTGTAAAGGTTGAAAAAGCTCATAATGCTGAT
                      ____________________________________________________________
consensus TGGGATGCTCGAGTTGGTACTAGTCCAGTTGTAAAGGTTGAAAAAGCTCATAATGCTGAT
 
. : . : . : . : . : . :
rJMSF035G13+ CTCCACTGTGTTGACTGGAATCCTCATGATGGCAACTTTATTATCACTGGATCTGCAGAT
JMFF032B09- CTCCACTGTGTTGACTGGAATCCTCATGATGGCAACTTTATTATCACTGGATCTGCAGAT
rJMFF024C16+ CTCCACTGTGTTGACTGGAATCCTCATGATGGCAACTTTATTATCACTGGATCTGCAGAT
rJMFF027E02+ CTCCACTGTGTTGACTGGAATCCTCATGATGGCAACTTTATTATCACTGGATCTGCAGAT
rJMSF043M18+ CTCCACTGTGTTGACTGGAATCCTCATGATGGCAACTTTATTATCACTGGATCTGCAGAT
rJMFF007A11+ CTCCACTGTGTTGACTGGAATCCTCATGATGGCAACTTTATTATCACTGGATCTGCAGAT
rJMSF040K15+ CTCCACTGTGTTGACTGGAATCCTCATGATGGCAACTTTATTATCACTGGATCTGCAGAT
rJMFF016M02+ CTCCACTGTGTTGACTGGAATCCTCATGATGGCAACTTTATTATCACTGGATCTGCAGAT
rJMFF025N12+ CTCCACTGTGTTGACTGGAATCCTCATGATGGCAACTTTATTATCACTGGATCTGCAGAT
rJMFF032B09+ TCTGCAGAT
                      ____________________________________________________________
consensus CTCCACTGTGTTGACTGGAATCCTCATGATGGCAACTTTATTATCACTGGATCTGCAGAT
 
. : . : . : . : . : . :
rJMSF035G13+ AATTCTGTCCGCTTGTTTGATCGACGTAGTTTAACTTCGAATGGAGTTGGCTCACCAGTC
JMFF032B09- AATTCTGTCCGCTTGTTTGATCGACGTAGTTTAACTTCGAATGGAGTTGGCTCACCAGTC
rJMFF024C16+ AATTCTGTCCGCTTGTTTGATCGACGTAGTTTAACTTCGAATGGAGTTGGCTCACCAGTC
rJMFF027E02+ AATTCTGTCCGCTTGTTTGATCGACGTAGTTTAACTTCGAATGGAGTTGGCTCACCAGTC
rJMSF043M18+ AATTCTGTCCGCTTGTTTGATCGACGTAGTTTAACTTCGAATGGAGTTGGCTCACCAGTC
rJMFF041N20+ TTTAACTTCGAATGGAGTTGGCTCACCAGTC
rJMFF007A11+ AATTCTGTCCGCTTGTTTGATCGACGTAGTTTAACTTCGAATGGAGTTGGCTCACCAGTC
rJMSF040K15+ AATTCTGTCCGCTTGTTTGATCGACGTAGTTTAACTTCGAATGGAGTTGGCTCACCAGTC
rJMFF016M02+ AATTCTGTCCGCTTGTTTGATCGACGTAGTTTAACTTCGAATGGAGTTGGCTCACCAGTC
rJMFF025N12+ AATTCTGTCCGCTTGTTTGATCGACGTAGTTTAACTTCGAATGGAGTTGGCTCACCAGTC
rJMFF032B09+ AATTCTGTCCGCTTGTTTGATCGACGTAGTTTAACTTCGAATGGAGTTGGCTCACCAGTC
                      ____________________________________________________________
consensus AATTCTGTCCGCTTGTTTGATCGACGTAGTTTAACTTCGAATGGAGTTGGCTCACCAGTC
 
. : . : . : . : . : . :
rJMSF035G13+ CATATCTTTGAAAATCACAAAGCAGCAGTTCTTTGTGTGCAGTGGTGTCCAGACAGGTCC
JMFF032B09- CATATCTTTGAAAATCACAAAGCAGCAGTTCTTTGTGTGCAGTGGTGTCCAGACAGGTCC
rJMFF024C16+ CATATCTTTGAAAATCACAAAGCAGCAGTTCTTTGTGTGCAGTGGTGTCCAGACAGGTCC
rJMFF027E02+ CATATCTTTGAAAATCACAAAGCAGCAGTTCTTTGTGTGCAGTGGTGTCCAGACAGGTCC
rJMSF043M18+ CATATCTTTGAAAATCACAAAGCAGCAGTTCTTTGTGTGCAGTGGTGTCCAGACAGGTCC
rJMFF041N20+ CATATCTTTGAAAATCACAAAGCAGCAGTTCTTTGTGTGCAGTGGTGTCCAGACAGGTCC
rJMFF007A11+ CATATCTTTGAAAATCACAAAGCAGCAGTTCTTTGTGTGCAGTGGTGTCCAGACAGGTCC
rJMSF040K15+ CATATCTTTGAAAATCACAAAGCAGCAGTTCTTTGTGTGCAGTGGTGTCCAGACAGGTCC
rJMFF016M02+ CATATCTTTGAAAATCACAAAGCAGCAGTTCTTTGTGTGCAGTGGTGTCCAGACAGGTCC
rJMFF025N12+ CATATCTTTGAAAATCACAAAGCAGCAGTTCTTTGTGTGCAGTGGTGTCCAGACAGGTCC
rJMFF032B09+ CATATCTTTGAAAATCACAAAGCAGCAGTTCTTTGTGTGCAGTGGTGTCCAGACAGGTCC
                      ____________________________________________________________
consensus CATATCTTTGAAAATCACAAAGCAGCAGTTCTTTGTGTGCAGTGGTGTCCAGACAGGTCC
 
. : . : . : . : . : . :
rJMSF035G13+ TCTGTATTTGGGAGTACTGCAGAGGATGGTCGTTTGAATATTTGGGATTACGATAAGGTT
JMFF032B09- TCTGTATTTGGGAGTACTGCAGAGGATGGTCGTTTGAATATTTGGGATTACGATAAGGTT
rJMFF024C16+ TCTGTATTTGGGAGTACTGCAGAGGATGGTCGTTTGAATATTTGGGATTACGATAAGGTT
rJMFF027E02+ TCTGTATTTGGGAGTACTGCAGAGGATGGTCGTTTGAATATTTGGGATTACGATAAGGTT
rJMSF043M18+ TCTGTATTTGGGAGTACTGCAGAGGATGGTCGTTTGAATATTTGGGATTACGATAAGGTT
rJMFF041N20+ TCTGTATTTGGGAGTACTGCAGAGGATGGTCGTTTGAATATTTGGGATTACGATAAGGTT
JMFN039D23- GTTTGAATATTTGGGATTACGATAAGGTT
rJMFF007A11+ TCTGTATTTGGGAGTACTGCAGAGGATGGTCGTTTGAATATTTGGGATTACGATAAGGTT
rJMSF040K15+ TCTGTATTTGGGAGTACTGCAGAGGATGGTCGTTTGAATATTTGGGATTACGATAAGGTT
rJMFF016M02+ TCTGTATTTGGGAGTACTGCAGAGGATGGTCGTTTGAATATTTGGGATTACGATAAGGTT
rJMFF025N12+ TCTGTATTTGGGAGTACTGCAGAGGATGGTCGTTTGAATATTTGGGATTACGATAAGGTT
rJMFF032B09+ TCTGTATTTGGGAGTACTGCAGAGGATGGTCGTTTGAATATTTGGGATTACGATAAGGTT
rJMFF042N08+ ACTGCAGAGGATGGTCGTTTGAATATTTGGGATTACGATAAGGTT
                      ____________________________________________________________
consensus TCTGTATTTGGGAGTACTGCAGAGGATGGTCGTTTGAATATTTGGGATTACGATAAGGTT
 
. : . : . : . : . : . :
rJMSF035G13+ GGTGAGAAGGACAATGAGACACCTGCTCCAGGTTTATTTTTCCAGCATGCTGGGCACAGG
JMFF032B09- GGTGTGAAGGACAATGAGACACCTGCTCCAGGTTTATTTTTCCAGCATGCTGGGCACAGG
rJMFF024C16+ GGTGAGAAGGACAATGAGACACCTGCTCCAGGTTTATTTTTCCAGCATGCTGGGCACAGG
rJMFF027E02+ GGTGAGAAGGACAATGAGACACCTGCTCCAGGTTTATTTTTCCAGCATGCTGGGCACAGG
rJMSF043M18+ GGTGAGAAGGACAATGAGACACCTGCTCCAGGTTTATTTTTCCAGCATGCTGGGCACAGG
rJMFF041N20+ GGTGAGAAGGACAATGAGACACCTGCTCCAGGTTTATTTTTCCAGCATGCTGGGCACAGG
JMFN039D23- GGTGAGAAGGACAATGAGACACCTGCTCCAGGTTTATTTTTCCAGCATGCTGGGCACAGG
rJMFF007A11+ GGTGAGAAGGACAATGAGACACCTGCTCCAGGTTTATTTTTCCAGCATGCTGGGCACAGG
rJMSF040K15+ GGTGAGAAGGACAATGAGACACCTGCTCCAGGTTTATTTTTCCAGCATGCTGGGCACAGG
rJMFF016M02+ GGTGAGAAGGACAATGAGACACCTGCTCCAGGTTTATTTTTCCAGCATGCTGGGCACAGG
rJMFF025N12+ GGTGAGAAGGACAATGAGACACCTGCTCCAGGTTTATTTTTCCAGCATGCTGGGCACAGG
rJMFF032B09+ GGTGTGAAGGACAATGAGACACCTGCTCCAGGTTTATTTTTCCAGCATGCTGGGCACAGG
rJMFF042N08+ GGTGAGAAGGACAATGAGACACCTGCTCCAGGTTTATTTTTCCAGCATGCTGGGCACAGG
                      ____________________________________________________________
consensus GGTGAGAAGGACAATGAGACACCTGCTCCAGGTTTATTTTTCCAGCATGCTGGGCACAGG
 
. : . : . : . : . : . :
rJMSF035G13+ GATAAAATTGTTGACTTCCACTGGAATGTGGCTGATCCATGGACAATTGTAAGTGTATCT
JMFF032B09- GATAAAATTGTTGACTTCCACTGGAATGTGGCTGATCCATGGACAATTGTAAGTGTATCT
rJMFF024C16+ GATAAAATTGTTGACTTCCACTGGAATGTGGCTGATCCATGGACAATTGTAAGTGTATCT
rJMFF027E02+ GATAAAATTGTTGACTTCCACTGGAATGTGGCTGATCCATGGACAATTGTAAGTGTATCT
rJMSF043M18+ GATAAAATTGTTGACTTCCACTGGAATGTGGCTGATCCATGGACAATTGTAAGTGTATCT
rJMFF041N20+ GATAAAATTGTTGACTTCCACTGGAATGTGGCTGATCCATGGACAATTGTAAGTGTATCT
JMFN039D23- GATAAAATTGTTGACTTCCACTGGAATGTGGCTGATCCATGGACAATTGTAAGTGTATCT
rJMFF007A11+ GATAAAATTGTTGACTTCCACTGGAATGTGGCTGATCCATGGACAATTGTAAGTGTATCT
rJMSF040K15+ GATAAAATTGTTGACTTCCACTGGAATGTGGCTGATCCATGGACAATTGTAAGTGTATCT
rJMFF016M02+ GATAAAATTGTTGACTTCCACTGGAATGTGGCTGATCCATGGACAATTGTAAGTGTATCT
rJMFF025N12+ GATAAAATTGTTGACTTCCACTGGAATGTGGCTGATCCATGGACAATTGTAAGTGTATCT
rJMFF032B09+ GATAAAATTGTTGACTTCCACTGGAATGTGGCTGATCCATGGACAATTGTAAGTGTATCT
rJMFF042N14+ TTGTTGACTTCCACTGGAATGTGGCTGATCCATGGACAATTGTAAGTGTATCT
rJMFF049C24+ AATTGTTGACTTCCACTGGAATGTGGCTGATCCATGGACAATTGTAAGTGTATCT
rJMFF042N08+ GATAAAATTGTTGACTTCCACTGGAATGTGGCTGATCCATGGACAATTGTAAGTGTATCT
                      ____________________________________________________________
consensus GATAAAATTGTTGACTTCCACTGGAATGTGGCTGATCCATGGACAATTGTAAGTGTATCT
 
. : . : . : . : . : . :
rJMSF035G13+ GATGACTGTGACTCCACAGGTGGAGGTGGTACACTACAGATATGGCGGATGTTGGATTTG
JMFF032B09- GATGACTGTGACTCCACAGGTGGAGGTGGTACACTACAGATATGGCGGATGTTGGATTTG
rJMFF024C16+ GATGACTGTGACTCCACAGGTGGAGGTGGTACACTACAGATATGGCGGATGTTGGATTTG
rJMFF027E02+ GATGACTGTGACTCCACAGGTGGAGGTGGTACACTACAGATATGGCGGATGTTGGATTTG
rJMSF043M18+ GATGACTGTGACTCCACAGGTGGAGGTGGTACACTACAGATATGGCGGATGTTGGATTTG
rJMFF041N20+ GATGACTGTGACTCCACAGGTGGAGGTGGTACACTACAGATATGGCGGATGTTGGATTTG
JMFN039D23- GATGACTGTGACTCCACAGGTGGAGGTGGTACACTACAGATATGGCGGATGTTGGATTTG
rJMFF007A11+ GATGACTGTGACTCCACAGGTGGAGGTGGTACACTACAGATATGGCGGATGTTGGATTTG
rJMSF040K15+ GATGACTGTGACTCCACAGGTGGAGGTGGTACACTACAGATATGGCGGATGTTGGATTTG
rJMFF016M02+ GATGACTGTGACTCCACAGGTGGAGGTGGTACACTACAGATATGGCGGATGTTGGATTTG
rJMFF025N12+ GATGACTGTGACTCCACAGGTGGAGGTGGTACACTACAGATATGGCGGATGTTGGATTTG
rJMFF032B09+ GATGACTGTGACTCCACAGGTGGAGGTGGTACACTACAGATATGGCGGATGTTGGATTTG
rJMFF042N14+ GATGACTGTGACTCCACAGGTGGAGGTGGTACACTACAGATATGGCGGATGTTGGATTTG
rJMFF049C24+ GATGACTGTGACTCCCCAGGTGGAGGTGGTACACTACAGATATGGCGGATGTTGGATTTG
rJMFF042N08+ GATGACTGTGACTCCACAGGTGGAGGTGGTACACTACAGATATGGCGGATGTTGGATTTG
                      ____________________________________________________________
consensus GATGACTGTGACTCCACAGGTGGAGGTGGTACACTACAGATATGGCGGATGTTGGATTTG
 
. : . : . : . : . : . :
rJMSF035G13+ CTGTATCGTCCTGAAGAGGAGGCTCTGGCCGAGCTTCAAAAATTCAAAGACCATGTAAGC
JMFF032B09- CTGTATCGTCCTGAAGAGGAGGCTCTGGCCGAGCTTCAAAAATT
rJMFF024C16+ CTGTATCGTCCTGAAGAGGAGGCTCTGGCCGAGCTTCAAAAATTCAAAGACCATGTAAGC
rJMFF027E02+ CTGTATCGTCCTGAAGAGGAGGCTCTGGCCGAGCTTCAAAAATTCAAAGACCATGTAAGC
rJMSF043M18+ CTGTATCGTCCTGAAGAGGAGGCTCTGGCCGAGCTTCAAAAATTCAAAGACCATGTAAGC
rJMFF041N20+ CTGTATCGTCCTGAAGAGGAGGCTCTGGCCGAGCTTCAAAAATTCAAAGACCATGTAAGC
JMFN039D23- CTGTATCGTCCTGAAGAGGAGGCTCTGGCCGAGCTTCAAAAATTCAAAGACCATGTAAGC
rJMFF007A11+ CTGTATCGTCCTGAAGAGGAGGCTCTGGCCGAGCTTCAAAAATTCAAAGACCATGTAAGC
rJMSF040K15+ CTGTATCGTCCTGAAGAGGAGGCTCTGGCCGAGCTTCAAAAATTCAAAGACCATGTAAGC
rJMFF016M02+ CTGTATCGTCCTGAAGAGGAGGCTCTGGCCGAGCTTCAAAAATTCAAAGACCATGTAAGC
rJMFF025N12+ CTGTATCGTCCTGAAGAGGAGGCTCTGGCCGAGCTTCAAAAATTCAAAGACCATGTAAGC
rJMFF032B09+ CTGTATCGTCCTGAAGAGGAGGCTCTGGCCGAGCTTCAAAAATTCAAAGACCATGTAAGC
rJMFF042N14+ CTGTATCGTCCTGAAGAGGAGGCTCTGGCCGAGCTTCAAAAATTCAAAGACCATGTAAGC
rJMFF049C24+ CTGTATCGTCCTGAAGAGGAGGCTCTGGCCGAGCTTCAAAAATTCAAAGACCATGTAAGC
rJMFF042N08+ CTGTATCGTCCTGAAGAGGAGGCTCTGGCCGAGCTTCAAAAATTCAAAGACCATGTAAGC
                      ____________________________________________________________
consensus CTGTATCGTCCTGAAGAGGAGGCTCTGGCCGAGCTTCAAAAATTCAAAGACCATGTAAGC
 
. : . : . : . : . : . :
rJMSF035G13+ AAGTGCGCTCCAAAATCTGATTCCTAAGTATTAAGTGCTTGTGTACTCATTACTCTGAAG
rJMFF024C16+ AAGTGCGCTCCAAAATCTGATTCCTAAGTATTAAGTGCTTGTGTACTCATTACTCTGAAG
rJMFF027E02+ AAGTGCGCTCCAAAATCTGATTCCTAAGTATTAAGTGCTTGTGTACTCATTACTCTGAAG
rJMSF043M18+ AAGTGCGCTCCAAAATCTGATTCCTAAGTATTAAGTGCTTGTGTACTCATTACTCTGAAG
rJMFF041N20+ AAGTGCGCTCCAAAATCTGATTCCTAAGTATTAAGTGCTTGTGTACTCATTACTCTGAAG
JMFN039D23- AAGTGCGCTCCAAAATCTGATTCCTAAGTATTAAGTGCTTGTGTACTCATTACTCTGAAG
rJMFF007A11+ AAGTGCGCTCCAAAATCTGATTCCTAAGTATTAAGTGCTTGTGTACTCATTACTCTGAAG
rJMSF040K15+ AAGTGCGCTCCAAAATCTGATTCCTAAGTATTAAGTGCTTGTGTACTCATTACTCTGAAG
rJMFF016M02+ AAGTGCGCTCCAAAATCTGATTCCTAAGTATTAAGTGCTTGTGTACTCATTACTCTGAAG
rJMFF025N12+ AAGTGCGCTCCAAAATCTGATTCCTAAGTATTAAGTGCTTGTGTACTCATTACTCTGAAG
rJMFF032B09+ AAGTGCGCTCCAAAATCTGATTCCTAAGTATTAAGTGCTTGTGTACTCATTACTCTGAAG
rJMFF042N14+ AAGTGCGCTCCAAAATCTGATTCCTAAGTATTAAGTGCTTGTGTACTCATTACTCTGAAG
rJMFF049C24+ AAGTGCGCTCCAAAATCTGATTCCTAAGTATTAAGTGCTTGTGTACTCATTACTCTGAAG
rJMFF042N08+ AAGTGCGCTCCAAAATCTGATTCCTAAGTATTAAGTGCTTGTGTACTCATTACTCTGAAG
                      ____________________________________________________________
consensus AAGTGCGCTCCAAAATCTGATTCCTAAGTATTAAGTGCTTGTGTACTCATTACTCTGAAG
 
. : . : . : . : . : . :
rJMSF035G13+ TATGAGTCTAGTAGTGTACCAATCCAAACATTGTGGGTGGGAACCCATTGTTAGGACTGT
rJMFF024C16+ TATGAGTCTAGTAGTGTACCAATCCAAACATTGTAGGTGGGAACCCATTGTTAGGACTGT
rJMFF027E02+ TATGAGTCTAGTAGTGTACCAATCCAAACATTGTAGGTGGGAACCCATTGTTAGGACTGT
rJMSF043M18+ TATGAGTCTAGTAGTGTACCAATCCAAACATTGTAGGTGGGAACCCATTGTTAGGACTGT
rJMFF041N20+ TATGAGTCTAGTAGTGTACCAATCCAAACATTGTAGGTGGGAACCCATTGTTAGGACTGT
JMFN039D23- TATGAGTCTAGTAGTGTACCAATCCAAACATTGTAGGTGGGAACCCATTGTTAGGACTGT
rJMFF007A11+ TATGAGTCTAGTAGTGTACCAATCCAAACATTGTAGGTGGGAACCCATTGTTAGGACTGT
rJMSF040K15+ TATGAGTCTAGTAGTGTACCAATCCAAACATTGTAGGTGGGAACCCATTGTTAGGACTGT
rJMFF016M02+ TATGAGTCTAGTAGTGTACCAATCCAAACATTGTAGGTGGGAACCCATTGTTAGGACTGT
rJMFF025N12+ TATGAGTCTAGTAGTGTACCAATCCAAACATTGTAGGTGGGAACCCATTGTTAGGACTGT
rJMFF032B09+ TATGAGTCTAGTAGTGTACCAATCCAAACATTGTAGGTGGGAACCCATTGTTAGGACTGT
rJMFF042N14+ TATGAGTCTAGTAGTGTACCAATCCAAACATTGTAGGTGGGAACCCATTGTTAGGACTGT
rJMFF049C24+ TATGAGTCTAGTAGTGTACCAATCCAAACATTGTAGGTGGGAACCCATTGTTAGGACTGT
rJMFF042N08+ TATGAGTCTAGTAGTGTACCAATCCAAACATTGTAGGTGGGAACCCATTGTTAGGACTGT
                      ____________________________________________________________
consensus TATGAGTCTAGTAGTGTACCAATCCAAACATTGTAGGTGGGAACCCATTGTTAGGACTGT
 
. : . : . : . : . : . :
rJMSF035G13+ CCCGTTAACTTTATAACCTTTTTGTGACTGAAGATA-TTGGAGCTGTGCT
rJMFF024C16+ CCCGTTAACTTTATAACCTTTTTGTGACTGAAGATATTTGGAGCTGTGCTTGATTA
rJMFF027E02+ CCCGTTAACTTTATAACCTTTTTGTGACTGAAGATATTTGGAGCTGTGCTTGATTATCCT
rJMSF043M18+ CCCGTTAACTTTATAACCTTTTTGTGACTGAAGATATTTGGAGCTGTGCTTGATTATCCT
rJMFF041N20+ CCCGTTAACTTTATAACCTTTTTGTGACTGAAGATATTTGGAGCTGTGCTTGATTATCCT
JMFN039D23- CCCGTTAACTTTATAACCTTTTTGTGACTGAAGATATTTGGAGCTGTGCTTGATTATCCT
rJMFF007A11+ CCCGTTAACTTTATAACCTTTTTGTGACTGAAGATATTTGGAGCTGTGCTTGATTATCCT
rJMSF040K15+ CCCGTTAACTTTATAACCTTTTTGTGACTGAAGATATTTGGAGCTGTGCTTGATTATCCT
rJMFF016M02+ CCCGTTAACTTTATAACCTTTTTGTGACTGAAGATATTTGGAGCTGTGCTTGATTATCCT
rJMFF025N12+ CCCGTTAACTTTATAACCTTTTTGTGACTGAAGATATTTGGAGCTGTGCTTGATTATCCT
rJMFF032B09+ CCCGTTAACTTTATAACCTTTTTGTGACTGAAGATATTTGGAGCTGTGCTTGATTATCCT
rJMFF042N14+ CCCGTTAACTTTATAACCTTTTTGTGACTGAAGATATTTGGAGCTGTGCTTGATTATCCT
rJMFF049C24+ CCCGTTAACTTTATAACCTTTTTGTGACTGAAGATATTTGGAGCTGTGCTTGATTATCCT
rJMFF042N08+ CCCGTTAACTTTATAACCTTTTTGTGACTGAAGATATTTGGAGCTGTGCTTGATTATCCT
                      ____________________________________________________________
consensus CCCGTTAACTTTATAACCTTTTTGTGACTGAAGATATTTGGAGCTGTGCTTGATTATCCT
 
. : . : . : . : . : . :
rJMFF027E02+ ATTTAAC--AGATTGTTTTGTTCCTAATGCG
rJMSF043M18+ ATTTAAC--AGATTGTTT
rJMFF041N20+ ATTTAAC--AGATTGTTTTGTTCCT
JMFN039D23- ATTTAAC--AGATTGTTTTGTTCCT
rJMFF007A11+ ATTTAAC--AGATTGTTTTGTTCCTAATGCGTA
rJMSF040K15+ ATTTAAACAAGATTGTTTTGTTCCTAATGCGTATGGAGTACCTACGTGAGTTTGAAGTCT
rJMFF016M02+ ATTTAAC--AGATTGTTTTGTTCCTAATGCGTATGGAGTACCTA-GTGAGTTTGAAGTCT
rJMFF025N12+ ATTTAAC--AGATTGTTTTGTTCCTAATGCGTATGGAGTACCTA-GTGAGTTTGAAGTCT
rJMFF032B09+ ATTTAAC--AGATTGTTTTGTTCCTAATGCGTATGGAGTACCTA-GTGAGTTTGAAGTCT
rJMFF042N14+ ATTTAAC--AGATTGTTTTGTTCCTAATGCGTATGGAGTACCTA-GTGAGTTTGAAGTCT
rJMFF049C24+ ATTTAAC--AGATTGTTTTGTTCCTAATGCGTATGGAGTCCCTA-GTGAGTTTGAAGTCT
rJMFF042N08+ ATTTAAC--AGATTGTTTTGTTCCTAATGCGTATGGAGTACCTA-GTGAGTTTGAAGTCT
                      ____________________________________________________________
consensus ATTTAAC--AGATTGTTTTGTTCCTAATGCGTATGGAGTACCTA-GTGAGTTTGAAGTCT
 
. : . : . : . : . : . :
rJMSF040K15+ ATGTTGTATCC
rJMFF016M02+ ATGTTGTATCCTAGACCTTGATACATGTTTATTTTAGTAT
rJMFF025N12+ ATGTTGTATCCTAGACCTTGATACATGTTTATTTTAGTATA
rJMFF032B09+ ATGTTGTATCCTAGACCTTGATACATGTTTATTTTAGTATAT
rJMFF042N14+ ATGTTGTATCCTAGACCTTGATACATGTTTATTTTAGTATATTGCACGTTCATTTT
rJMFF049C24+ ATGTTGTATCCTAGACCTTGATACATGTTTATTTTAGTATAT
rJMFF042N08+ ATGTTGTATCCTAGACCTTGATACATGTTTATTTTAGTATATTGCACGTTCATTTTAACC
                      ____________________________________________________________
consensus ATGTTGTATCCTAGACCTTGATACATGTTTATTTTAGTATATTGCACGTTCATTTTAACC