Previous Contig 010253:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF042M23Sequence655014943gb:AP003274_18269882e-36Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051618010253 (2)gb:AC130604_17408159e-26Oryza sativa (japonica cultivar-group) chromosome 5 clone B1155G07, complete seq
JMFN005M19Sequence624010253 (2)gb:AY072140_15670335e-64Arabidopsis thaliana unknown protein (At1g55900) mRNA, complete cds.>gb:AY122975

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN005M19- CGTGACAGAGGCTGGA
                      ____________________________________________________________
consensus CGTGACAGAGGCTGGA
 
. : . : . : . : . : . :
JMFN005M19- GGACTTTCAAGAGACCTGGAGTTGATGCTTTCCTGGAACATTTAGCTCAGTTTTTTGAGA
                      ____________________________________________________________
consensus GGACTTTCAAGAGACCTGGAGTTGATGCTTTCCTGGAACATTTAGCTCAGTTTTTTGAGA
 
. : . : . : . : . : . :
JMFN005M19- TTGTTGTATACTCTGATCAGCAGAGCATGTATGTTGATCCTGTTGTCGAAAGATTGGATC
                      ____________________________________________________________
consensus TTGTTGTATACTCTGATCAGCAGAGCATGTATGTTGATCCTGTTGTCGAAAGATTGGATC
 
. : . : . : . : . : . :
JMFN005M19- CAAAGAACTGTATCCGGTATAGGCTATCAAGAGGTGCAACTAAATATCTCAATGGCAAGC
                      ____________________________________________________________
consensus CAAAGAACTGTATCCGGTATAGGCTATCAAGAGGTGCAACTAAATATCTCAATGGCAAGC
 
. : . : . : . : . : . :
JMFN005M19- ATTATAGAGATCTTTCAATGCTGAACAGAGATCCCTCAAAGGTTATATATATCAGTGGTC
rJMFF042M23+ TTATATATATCAGTGGTC
                      ____________________________________________________________
consensus ATTATAGAGATCTTTCAATGCTGAACAGAGATCCCTCAAAGGTTATATATATCAGTGGTC
 
. : . : . : . : . : . :
JMFN005M19- ATGCACTTGAAAGCAGCCTTCAACCAGAAAATTGTTTGGAAATCAAACCATGGACAGGAG
rJMFF042M23+ ATGCACTTGAAAGCAGCCTTCAACCAGAAAATTGTTTGGAAATCAAACCATGGACAGGAG
                      ____________________________________________________________
consensus ATGCACTTGAAAGCAGCCTTCAACCAGAAAATTGTTTGGAAATCAAACCATGGACAGGAG
 
. : . : . : . : . : . :
JMFN005M19- AATCTGAAGATACAGCACTTTTGGATCTTATTCCATTTCTTGAATATGTTGGCAAGCATA
rJMFF042M23+ AATCTGAAGATACAGCACTTTTGGATCTTATTCCATTTCTTGAATATGTTGGCAAGCATA
                      ____________________________________________________________
consensus AATCTGAAGATACAGCACTTTTGGATCTTATTCCATTTCTTGAATATGTTGGCAAGCATA
 
. : . : . : . : . : . :
JMFN005M19- GGCCAGGTGATATACGAGCTGTTTTATCTTCATACGAAGGGCGTGATGTTGCCAAGGAGT
rJMFF042M23+ GGCCAGGTGATATACGAGCTGTTTTATCTTCATACGAAGGGCGTGATGTTTCCAAGGAGT
                      ____________________________________________________________
consensus GGCCAGGTGATATACGAGCTGTTTTATCTTCATACGAAGGGCGTGATGTTTCCAAGGAGT
 
. : . : . : . : . : . :
JMFN005M19- TCATTGAACGGTCTAAGGAGCATCAGAGGCGAATGCAAGAGCAAAAGCAGCAGGGTCGTA
rJMFF042M23+ TCATTGAACGGTCTAAGGAGCATCAGAGGCGAATGCAAGAGCAAAAGCAGCAGGGTCGTA
                      ____________________________________________________________
consensus TCATTGAACGGTCTAAGGAGCATCAGAGGCGAATGCAAGAGCAAAAGCAGCAGGGTCGTA
 
. : . : . : . : . : . :
JMFN005M19- TCTGGCGCCGCTAGATACAAGGATTGGCTAACTGTAGGATTGTATACTTGTTCGAGACAA
rJMFF042M23+ TCTGGCGCCGCTAGATACAAGGATTGGCTAACTGTAGGATTGTATACTTGTTCGAGACAA
                      ____________________________________________________________
consensus TCTGGCGCCGCTAGATACAAGGATTGGCTAACTGTAGGATTGTATACTTGTTCGAGACAA
 
. : . : . : . : . : . :
JMFN005M19- TGAACAACAACAACTATTACTACTGTGAAGTAGTAGCAACCAATTTTGTGTAGTTAATAA
rJMFF042M23+ TGAACAACAACAACTATTACTACTGTGAAGTAGTAGCAACCAATTTTGTGTAGTTAATAA
                      ____________________________________________________________
consensus TGAACAACAACAACTATTACTACTGTGAAGTAGTAGCAACCAATTTTGTGTAGTTAATAA
 
. : . : . : . : . : . :
JMFN005M19- TTCCATCC
rJMFF042M23+ TTCCATCCTTGTTTGGAGATGACCCTTTTTCAACTCCAGCCTACTGCACTCTTCCATTAA
                      ____________________________________________________________
consensus TTCCATCCTTGTTTGGAGATGACCCTTTTTCAACTCCAGCCTACTGCACTCTTCCATTAA
 
. : . : . : . : . : . :
rJMFF042M23+ ATATCTTTACCCTAGCTTAAATCAACTTCATGTTTAACCCCATATTATTATGAGTCACAC
                      ____________________________________________________________
consensus ATATCTTTACCCTAGCTTAAATCAACTTCATGTTTAACCCCATATTATTATGAGTCACAC
 
. : . : . : . : . : . :
rJMFF042M23+ TTGTGTGAGATATGTGAGAGAGGTTAGACCTAAGATAATTGTTTGTTACTTATGATAAAA
                      ____________________________________________________________
consensus TTGTGTGAGATATGTGAGAGAGGTTAGACCTAAGATAATTGTTTGTTACTTATGATAAAA
 
. : . : . : . : . : . :
rJMFF042M23+ ATCATAATATTTATTGCAGAAAATTTAATATTAATTTGAAATAAATAAATTGTTACTTAT
                      ____________________________________________________________
consensus ATCATAATATTTATTGCAGAAAATTTAATATTAATTTGAAATAAATAAATTGTTACTTAT