Previous Contig 010249:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005M09Sequence507005198 (5)gb:AF123390_17698891e-62Arabidopsis thaliana 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, compl729010249 (9)sp|O64982|PRS7_PRUPE4e-9426S protease regulatory subunit 7 (26S proteasome subunit 7) (26S proteasome AAA
JMFF011A13Sequence513005198 (5)gb:AF123390_17698891e-93Arabidopsis thaliana 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, compl729010249 (9)sp|O64982|PRS7_PRUPE4e-8426S protease regulatory subunit 7 (26S proteasome subunit 7) (26S proteasome AAA
JMFF018K20Sequence466010249 (9)gb:AF123390_17698898e-23Arabidopsis thaliana 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, compl807010249 (9)sp|O64982|PRS7_PRUPE1e-8226S protease regulatory subunit 7 (26S proteasome subunit 7) (26S proteasome AAA
JMFF022C14Sequence343010249 (9)gb:AF123390_17698890.002Arabidopsis thaliana 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, compl
JMFF042L18Sequence645005198 (5)gb:AF123390_17698894e-88Arabidopsis thaliana 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, compl612010249 (9)sp|O64982|PRS7_PRUPE5e-5526S protease regulatory subunit 7 (26S proteasome subunit 7) (26S proteasome AAA
JMFN017P18Sequence606010249 (9)sp|O64982|PRS7_PRUPE3e-7526S protease regulatory subunit 7 (26S proteasome subunit 7) (26S proteasome AAA
JMSF009B23Sequence268005198 (5)gb:AF123390_17698894e-44Arabidopsis thaliana 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, compl770010249 (9)sp|O64982|PRS7_PRUPEe-10426S protease regulatory subunit 7 (26S proteasome subunit 7) (26S proteasome AAA
JMSF011A09Sequence202005198 (5)gb:AF123390_17698891e-12Arabidopsis thaliana 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, compl779010249 (9)sp|O64982|PRS7_PRUPEe-10626S protease regulatory subunit 7 (26S proteasome subunit 7) (26S proteasome AAA

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF018K20- AAAGAACCTTATC
                      ____________________________________________________________
consensus AAAGAACCTTATC
 
. : . : . : . : . : . :
JMFF018K20- ATCTCCTCTCTCTCTAAAAGTCATTCAGTCTCCACTGCTACAGAGTGAATCATGGCCGAC
                      ____________________________________________________________
consensus ATCTCCTCTCTCTCTAAAAGTCATTCAGTCTCCACTGCTACAGAGTGAATCATGGCCGAC
 
. : . : . : . : . : . :
JMFF018K20- GCTATCATCTCCATTGTTGTGGATCAGCTGTCCATCATCATCAAGGAACAAGCCCAGGAG
                      ____________________________________________________________
consensus GCTATCATCTCCATTGTTGTGGATCAGCTGTCCATCATCATCAAGGAACAAGCCCAGGAG
 
. : . : . : . : . : . :
JMFF018K20- CTAAGAGCAGCGTTGGGTGTGGAGAAGGAGATCAAAAACCTCTCATCAAAGCTCAACAAA
rJMFF018K20+ AAAGCTCAACAAA
                      ____________________________________________________________
consensus CTAAGAGCAGCGTTGGGTGTGGAGAAGGAGATCAAAAACCTCTCATCAAAGCTCAACAAA
 
. : . : . : . : . : . :
JMFF018K20- ATCAGGG-CGGTGTTGGTCGATGCAGAGAGGAGAAGCTTCAAGGAAGAGAGCGTCAAGCT
rJMFF018K20+ ATCAGGGCCGGTGTTGGTCGATGCAGAGAGGAGAAGCTTCAAGGAAGAGAGCGTCAAGCT
                      ____________________________________________________________
consensus ATCAGGGCCGGTGTTGGTCGATGCAGAGAGGAGAAGCTTCAAGGAAGAGAGCGTCAAGCT
 
. : . : . : . : . : . :
JMFF018K20- GTGGGTGGAAGAGATGAAAGCCTTCTGCTATGATGTGGAAGATGTTCTTGACGAGTGGAG
rJMFF005M09+ GGAG
rJMSF011A09+ GGAG
rJMSF009B23+ GGAG
rJMFF018K20+ GTGGGTGGAAGAGATGAAAGCCTTCTGCTATGATGTGGAAGATGTTCTTGACGAGTGGAG
rJMFF011A13+ AAGTAGATGNTATTG----GGGGAG
                      ____________________________________________________________
consensus GTGGGTGGAAGAGATGAAAGCCTTCTGCTATGATGTGGAAGATGTTCTTGACGAGTGGAG
 
. : . : . : . : . : . :
JMFF018K20- CACGATTTGATGATGGTGTAGGGGGAGACAATGAAGTTCAACGAACTATGCTTGAAATTG
JMFN017P18- TGAAGTTCAACGAACTATGCTTGAAATTG
rJMFF005M09+ CACGATTTGATGATGGTGTAGGGGGAGACAATGAAGTTCAACGAACTATGCTTGAAATTG
rJMSF011A09+ CACGATTTGATGATGGTGTAGGGGGAGACAATGAAGTTCAACGAACTATGCTTGAAATTG
rJMSF009B23+ CACGATTTGATGATGGTGTAGGGGGAGACAATGAAGTTCAACGAACTATGCTTGAAATTG
rJMFF018K20+ CACGATTTGATGATGGTGTAGGGGGAGACAATGAAGTTCAACGAACTATGCTTGAAATTG
rJMFF011A13+ CACGATTTGATGATGGTGTAGGGGGAGACAATGAAGTTCAACGAACTATGCTTGAAATTG
                      ____________________________________________________________
consensus CACGATTTGATGATGGTGTAGGGGGAGACAATGAAGTTCAACGAACTATGCTTGAAATTG
 
. : . : . : . : . : . :
JMFF018K20- TGAACCAGCTTGATGGCTTTGATGCACGTGGGAATATTAAAGTACTCATGGCAACAAATA
JMFN017P18- TGAACCAGCTTGATGGCTTTGATGCACGTGGGAATATTAAAGTACTCATGGCAACAAATA
rJMFF005M09+ TGAACCAGCTTGATGGCTTTGATGCACGTGGGAATATTAAAGTACTCATGGCAACAAATA
rJMSF011A09+ TGAACCAGCTTGATGGCTTTGATGCACGTGGGAATATTAAAGTACTCATGGCAACAAATA
rJMSF009B23+ TGAACCAGCTTGATGGCTTTGATGCACGTGGGAATATTAAAGTACTCATGGCAACAAATA
rJMFF018K20+ TGAACCAGCTTGATGGCTTTGATGCACGTGGGAATATTAAAGTACTCATGGCAACAAATA
rJMFF011A13+ TGAACCAGCTNGATGGCTTTGATGCACGTGGGAATATTAAAGTACTCATGGCAACAAATA
rJMFF042L18+ CATGGCAACAAATA
                      ____________________________________________________________
consensus TGAACCAGCTTGATGGCTTTGATGCACGTGGGAATATTAAAGTACTCATGGCAACAAATA
 
. : . : . : . : . : . :
JMFF018K20- GACCTGACACCCTTGATCCAGCACTACTGCGTCC
JMFN017P18- GACCTGACACCCTTGATCCAGCACTACTGCGTCCTGGACGGTTGGATCGCAAAGTCGAGT
rJMFF005M09+ GACCTGACACCCTTGATCCAGCACTACTGCGTCCTGGACGGTTGGATCGCAAAGTCGAGT
rJMSF011A09+ GACCTGACACCCTTGATCCAGCACTACTGCGTCCTGGACGGTTGGATCGCAAAGTCGAGT
rJMSF009B23+ GACCTGACACCCTTGATCCAGCACTACTGCGTCCTGGACGGTTGGATCGCAAAGTCGAGT
rJMFF018K20+ GACCTGACACCCTTGATCCAGCACTACTGCGTCCTGGACGGTTGGATCGCAAAGTCGAGT
rJMFF011A13+ GACNTGACACCCTTGATCCAGCACTACTGCGTCCTGGACGGTTGGATCGCAAAGTCGAGT
rJMFF042L18+ GACCTGACACCC-TGATCCAGCACTACTGCGTCCTGGACGGTTGGATCGCAAAGTCGAGT
                      ____________________________________________________________
consensus GACCTGACACCCTTGATCCAGCACTACTGCGTCCTGGACGGTTGGATCGCAAAGTCGAGT
 
. : . : . : . : . : . :
JMFN017P18- TTGGTTTGCCTGATCTGGAAAGCAGGACACAGATTTTCAAGATTCACACGAGGACAATGA
rJMFF005M09+ TTGGTTTGCCTGATCTGGAAAGCAGGACACAGATTTTCAAGATTCACACGAGGACAATGA
rJMSF011A09+ TTGGTTTGCCTGATCTGGAAAGCAGGACACAGATTTTCAAGATTCACACGAGGACAATGA
rJMSF009B23+ TTGGTTTGCCTGATCTGGAAAGCAGGACACAGATTTTCAAGATTCACACGAGGACAATGA
rJMFF018K20+ TTGGTTTGCCTGATCTGGAAAGCAGGACACAGATTTTCAAGATTCACACGAGGACAATGA
rJMFF011A13+ TTGGTTTGCCTGATCTGGAAAGCAGGACACAGATTTTCAAGATTCACACGAGGACAATGA
rJMFF042L18+ TTGGTTTGCCTGATCTGGAAAGCAGGACACAGATTTTCAAGATTCACACGAGGACAATGA
                      ____________________________________________________________
consensus TTGGTTTGCCTGATCTGGAAAGCAGGACACAGATTTTCAAGATTCACACGAGGACAATGA
 
. : . : . : . : . : . :
JMFN017P18- ACTGTGAAAGAGACATCCGTTTTGAACTTCTAGCCCGTCTTTGTCCCAACTCTACCGGAG
rJMFF005M09+ ACTGTGAAAGAGACATCCGTTTTGAACTTCTAGCCCGTCTTTGTCCCAACTCTACCGGAG
rJMSF011A09+ ACTGTGAAAGAGACATCCGTTTTGAACTTCTAGCCCGTCTTTGTCCCAACTCTACCGGAG
rJMSF009B23+ ACTGTGAAAGAGACATCCGTTTTGAACTTCTAGCCCGTCTTTGTCCCAACTCTACCGGAG
rJMFF018K20+ ACTGTGAAAGAGACATCCGTTTTGAACTTCTAGCCCGTCTTTGTCCCAACTCTACCGGAG
rJMFF011A13+ ACTGTGAAAGAGACATCCGTTTTGAACTTCTAGCCCGTCTTTGTCCCAACTCTACCGGAG
rJMFF042L18+ ACTGTGAAAGAGACATCCGTTTTGAACTTCTAGCCCGTCTTTGTCCCAACTCTACCGGAG
                      ____________________________________________________________
consensus ACTGTGAAAGAGACATCCGTTTTGAACTTCTAGCCCGTCTTTGTCCCAACTCTACCGGAG
 
. : . : . : . : . : . :
JMFN017P18- CTGACATAAGAAGTGTTTGCACCGAGGCTGGAATGTACGCAATTCGAGCACGAAGAAAGA
rJMFF005M09+ CTGACATAAGAAGTGTTTGCACCGAGGCTGGAATGTACGCAATTCGAGCACGAAGAAAGA
rJMSF011A09+ CTGACATAAGAAGTGTTTGCACCGAGGCTGGAATGTACGCAATTCGAGCACGAAGAAAGA
rJMSF009B23+ CTGACATAAGAAGTGTTTGCACCGAGGCTGGAATGTACGCAATTCGAGCACGAAGAAAGA
rJMFF018K20+ CTGACATAAGAAGTGTTTGCACCGAGGCTGGAATGTACGCAATTCGAGCACGAAGAAAGA
rJMFF011A13+ CTGACATAAGAAGTGTTTGCACCGAGGCTGGAATGTACGCAATTCGAGCACGAAGAAAGA
rJMFF042L18+ CTGACATAAGAATTGTTTGCACCGAGGCTGGAATGTACGCAATTCGAGCACGAAGAAAGA
                      ____________________________________________________________
consensus CTGACATAAGAAGTGTTTGCACCGAGGCTGGAATGTACGCAATTCGAGCACGAAGAAAGA
 
. : . : . : . : . : . :
rJMFF022C14+ CCGTCAACAAAGTCATCAAAGGGTNCCNGAAAT
JMFN017P18- CTGTTACAGAGAAGGACTTTCTAGATGCCGTCAACAAAGTCATCAAAGGGTACCAGAAAT
rJMFF005M09+ CTGTTACAGAGAAGGACTTTCTAGATGCCGTCAACAAAGTCATCAAAGGGTACCAGAAAT
rJMSF011A09+ CTGTTACAGAGAAGGACTTTCTAGATGCCGTCAACAAAGTCATCAAAGGGTACCAGAAAT
rJMSF009B23+ CTGTTACAGAGAAGGACTTTCTAGATGCCGTCAACAAAGTCATCAAAGGGTACCAGAAAT
rJMFF018K20+ CTGTTACAGAGAAGGACTTTCTAGATGCCGTCAACAAAGTCATCAAAGGGTACCAGAAAT
rJMFF011A13+ CTGTTACAGAGAAGGACTTTCTAGATGCCGTCAACAAAGTCATCAAAGGGTACCAGAAAT
rJMFF042L18+ CTGTTACAGAGAAGGACTTTCTAGATGCCGTCAACAAAGTCATCAAAGGGTACCAGAAAT
                      ____________________________________________________________
consensus CTGTTACAGAGAAGGACTTTCTAGATGCCGTCAACAAAGTCATCAAAGGGTACCAGAAAT
 
. : . : . : . : . : . :
rJMFF022C14+ TCAGNGCCCCTCCAAAATACATGGTTTNCAATTGATTTTTCCTNCTGGTTTTTGTCCCTT
JMFN017P18- TCAGTGCCACTCCAAAATACATGGTCTACAATTGATCCTTCCTGCTGGTTTTTGTCACTT
rJMFF005M09+ TCAGTGCCACTCCAAAATACATGGTCTACAATTGATCCTTCCTGCTGGTTTTTGTCACTT
rJMSF011A09+ TCAGTGCCACTCCAAAATACATGGTCTACAATTGATCCTTCCTGCTGGTTTTTGTCACTT
rJMSF009B23+ TTAGTGCCACTCCAAAATACATGGTCTACAATTGATCCTTCCTGCTGGTTTTTGTCACTT
rJMFF018K20+ TCAGTGCCACTCCAAAATACATGGTCTACAATTGATCCTTCCTGCTGGTTTTTGTCACTT
rJMFF011A13+ TCAGTGCCACTCCAAAATACATGGTCTACAATTGATCCTTCCTGCTGGTTTTTGTCACTT
rJMFF042L18+ TCAGTGCCACTCCAAAATACATGGTCTACAATTGATCCTTCCTGCTGGTTTTTGTCACTT
                      ____________________________________________________________
consensus TCAGTGCCACTCCAAAATACATGGTCTACAATTGATCCTTCCTGCTGGTTTTTGTCACTT
 
. : . : . : . : . : . :
rJMFF022C14+ CCCATAAAAGAAA
JMFN017P18- CTCATAAAAGAAATGAAGGGTTCTGGTCTGGTTCCAACTTGAAACTTATTAGCTGCATAG
rJMFF005M09+ CTCATAAAAGAAATGAAGGGTTCTGGTCTGGTTCCAACTTGAAACTTATTAGCTGCATAG
rJMSF011A09+ CTCATAAAAGAAATGAAGGGTTCTGGTCTGGTTCCAACTTGAAACTTATTAGCTGCATAG
rJMSF009B23+ CTCATAAAAGAAATGAAGGGTTCTGGTCTGGTTCCAACTTGAAACTTATTAGCTGCATAG
rJMFF018K20+ CTCATAAAAGAAATGAAGGGTTCTGGTCTGGTTCCAACTTGAAACTTATTAGCTGCATAG
rJMFF011A13+ CTCATAAAAGAAATGAAGGGTTCTGGTCTGGTTCCAACTTGAAACTTATTAGCTGCATAG
rJMFF042L18+ CTCATAAAAGAAATGAAGGGTTCTGGTCTGGTTCCAACTTGAAACTTATTAGCTGCATAG
                      ____________________________________________________________
consensus CTCATAAAAGAAATGAAGGGTTCTGGTCTGGTTCCAACTTGAAACTTATTAGCTGCATAG
 
. : . : . : . : . : . :
JMFN017P18- CTGTCCCCAGACTTGTGCCAGTTCCCTCCCATAACAACTTGCAGTTACCTCTGAGTCTAT
rJMFF005M09+ CTGTCCCCAGACTTGTGCCAGTTCCCTCCCATAACAACTTGCAGTTACCTCTGAGTCTAT
rJMSF011A09+ CTGTCCCCAGACTTGTGCCAGTTCCCTCCCATAACAACTTGCAGTTACCTCTGAGTCTAT
rJMSF009B23+ CTGTCCCCAGACTTGTGCCAGTTCCCTCCCATAACAACTTGCAGTTACCTCTGAGTCTAT
rJMFF018K20+ CTGTCCCCAGACTTGTGCCAGTTCCCTCCCATAACAACTTGCAGTTACCTCTGAGTCTAT
rJMFF011A13+ CTGTCCCCAGACTTGTGCCAGTTCCCTCCCATAACAACTTGCAGTTACCTCTGAGTCTAT
rJMFF042L18+ CTGTCCCCAGACTTGTGCCAGTTCCCTCCCATAACAACTTGCAGTTACCTCTGAGTCTAT
                      ____________________________________________________________
consensus CTGTCCCCAGACTTGTGCCAGTTCCCTCCCATAACAACTTGCAGTTACCTCTGAGTCTAT
 
. : . : . : . : . : . :
JMFN017P18- CTGTTTCTGCAGTTNTTATATTCAGAA
rJMFF005M09+ CTGTTTCTGCAGTTTTTATATTCAGAAGCTCCATGTGTGAAGTCTCAACATTTCTTAA
rJMSF011A09+ CTGTTTCTGCAGTTTTTATATTCAGAAGCTCCATGTGTGAAGTCTCAAC
rJMSF009B23+ CTGTTTCTGCAGTTTTTATATTCAGAAGCTCCATGTGTGAAGTCTCAACATT
rJMFF018K20+ CTGTTTCTGCAGTTTTTATATTCAGAAGCTCCATGTGTGAAGTCTCAACATTTCTTAACT
rJMFF011A13+ CTGTTTCTGCAGTTTTTATATTCAGAAGCTCCATGTGTGAAGTCTCAACATTTCTTAACT
rJMFF042L18+ CTGTTTCTGCAGTTTTTATATTCAGAAGCTCCATGTGTGAAGTCTCAACATTTCTTAACT
                      ____________________________________________________________
consensus CTGTTTCTGCAGTTTTTATATTCAGAAGCTCCATGTGTGAAGTCTCAACATTTCTTAACT
 
. : . : . : . : . : . :
rJMFF018K20+ TTTCTTGAATTCAT
rJMFF011A13+ TTTCTTGAATTCATTGGATCTTCATTTTAAGACATGCTTATCAAGTTT
rJMFF042L18+ TTTCTTGAATTCA-TGGATCTTCATTTTAAGACATGCTTATCAAGTTTATAAATTTATAG
                      ____________________________________________________________
consensus TTTCTTGAATTCATTGGATCTTCATTTTAAGACATGCTTATCAAGTTTATAAATTTATAG