Previous Contig 010248:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007E10Sequence592003239 (6)gb:AP003990_18360121e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10752010248 (5)gb:AP003990_18360129e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFF025P14Sequence576003239 (6)gb:AP003990_18360121e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10803010248 (5)gb:AP003990_18360126e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFF037N07Sequence159003239 (6)779010248 (5)gb:AP003990_18360125e-36Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFF042L16Sequence632003239 (6)gb:AP003990_18360126e-62Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10559010248 (5)gb:AB023482_15155966e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone P0680A03
JMSF012E23Sequence216003239 (6)721010248 (5)gb:AY086096_15711544e-30Arabidopsis thaliana clone 21250 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF007E10+ ATGGCGCAACGCATGTGACCACC
                      ____________________________________________________________
consensus ATGGCGCAACGCATGTGACCACC
 
. : . : . : . : . : . :
rJMFF007E10+ AGAGTAAAGGGCACGCTCGGTTATCTTGCCCCGGAATACGCAATGCTAGGGAAGGCATCA
rJMFF025P14+ CCGGAATACGCAATGCTAGGGAAGGCATCA
rJMFF037N07+ GGCATCA
                      ____________________________________________________________
consensus AGAGTAAAGGGCACGCTCGGTTATCTTGCCCCGGAATACGCAATGCTAGGGAAGGCATCA
 
. : . : . : . : . : . :
rJMFF007E10+ GAAAGCTGCGATGTTTTCAGCTTTGGCATTCTTTTACTAGAGCTCGCTAGTGGCAAGAAA
rJMSF012E23+ GCATTCTTTTACTAGAGCTCGCTAGTGGCAAGAAA
rJMFF025P14+ GAAAGCTGCGATGTTTTCAGCTTTGGCATTCTTTTACTAGAGCTCGCTAGTGGCAAGAAA
rJMFF037N07+ GAAAGCTGCGATGTTTTCAGCTTTGGCATTCTTTTACTAGAGCTCGCTAGTGGCAAGAAA
                      ____________________________________________________________
consensus GAAAGCTGCGATGTTTTCAGCTTTGGCATTCTTTTACTAGAGCTCGCTAGTGGCAAGAAA
 
. : . : . : . : . : . :
rJMFF007E10+ CCGATAGAGAAGGTGAGTGCAACGATGAAGCGCACGATCACGGACTGGGCCCTACCTTTG
rJMSF012E23+ CCGATAGAGAAGGTGAGTGCAACGATGAAGCGCACGATCACGGACTGGGCCCTACCTTTG
rJMFF025P14+ CCGATAGAGAAGGTGAGTGCAACGATGAAGCGCACGATCACGGACTGGGCCCTACCTTTG
rJMFF037N07+ CCGATAGAGAAGGTGAGTGCAACGATGAAGCGCACGATCACGGACTGGGCCCTACCTTTG
                      ____________________________________________________________
consensus CCGATAGAGAAGGTGAGTGCAACGATGAAGCGCACGATCACGGACTGGGCCCTACCTTTG
 
. : . : . : . : . : . :
rJMFF007E10+ GCCTGCGAAAGAAAATTCAGCGAACTTGCAGACCAAAGGTTGAATGGAAACTACGTGGAA
rJMSF012E23+ GCCTGCGAAAGAAAATTCAGCGAACTTGCAGACCAAAGGTTGAATGGAAACTACGTGGAA
rJMFF025P14+ GCCTGCGAAAGAAAATTCAGCGAACTTGCAGACCAAAGGTTGAATGGAAACTACGTGGAA
rJMFF037N07+ GCCTGCGAAAGAAAATTCAGCGAACTTGCAGACCAAAGGTTGAATGGAAACTACGTGGAA
                      ____________________________________________________________
consensus GCCTGCGAAAGAAAATTCAGCGAACTTGCAGACCAAAGGTTGAATGGAAACTACGTGGAA
 
. : . : . : . : . : . :
rJMFF007E10+ GAAGAGCTAAAAAGAGTGGTCTACGTGGCACTCGTTTGTGCTCAAAACCAAGCTGAGAAG
rJMSF012E23+ GAAGAGCTAAAAAGAGTGGTCTACGTGGCACTCGTTTGTGCTCAAAACCAAGCTGAGAAG
rJMFF025P14+ GAAGAGCTAAAAAGAGTGGTCTACGTGGCACTCGTTTGTGCTCAAAACCAAGCTGAGAAG
rJMFF037N07+ GAAGAGCTAAAAAGAGTGGTCTACGTGGCACTCGTTTGTGCTCAAAACCAAGCTGAGAAG
rJMFF042L16+ TCAAAACCAAGCTGAGAAG
                      ____________________________________________________________
consensus GAAGAGCTAAAAAGAGTGGTCTACGTGGCACTCGTTTGTGCTCAAAACCAAGCTGAGAAG
 
. : . : . : . : . : . :
rJMFF007E10+ AGACCAACAATGCTCGAGGTGGTTGAGATCCTGAAAGGCGAATCGAAGGAGAAGTTTGCC
rJMSF012E23+ AGACCAACAATGCTCGAGGTGGTTGAGATCCTGAAAGGCGAATCGAAGGAGAAGTTTGCC
rJMFF025P14+ AGACCAACAATGCTCGAGGTGGTTGAGATCCTGAAAGGCGAATCGAAGGAGAAGTTTGCC
rJMFF037N07+ AGACCAACAATGCTCGAGGTGGTTGAGATCCTGAAAGGCGAATCGAAGGAGAAGTTTGCC
rJMFF042L16+ AGACCAACAATGCTCGAGGTGGTTGAGATCCTGAAAGGCGAATCGAAGGAGAAGTTTGCC
                      ____________________________________________________________
consensus AGACCAACAATGCTCGAGGTGGTTGAGATCCTGAAAGGCGAATCGAAGGAGAAGTTTGCC
 
. : . : . : . : . : . :
rJMFF007E10+ GCTCTAGAGAACGATGAACTGTTCAAAAATCCTCAGGCTGCTGCTAAAGACGAGTTATCT
rJMSF012E23+ GCTCTAGAGAACGATGAACTGTTCAAAAATCCTCAGGCTGCTGCTAAAGACGAGTTATCT
rJMFF025P14+ GCTCTAGAGAACGATGAACTGTTCAAAAATCCTCAGGCTGCTGCTAAAGACGAGTTATCT
rJMFF037N07+ GCTCTAGAGAACGATGAACTGTTCAAAAATCCTCAGGCTGCTGCTAAAGACGAGTTATCT
rJMFF042L16+ GCTCTAGAGAACGATGAACTGTTCAAAAATCCTCAGGCTGCTGCTAAAGACGAGTTATCT
                      ____________________________________________________________
consensus GCTCTAGAGAACGATGAACTGTTCAAAAATCCTCAGGCTGCTGCTAAAGACGAGTTATCT
 
. : . : . : . : . : . :
rJMFF007E10+ GGAGCAGAGGACAGTTCAGAGTTCATCTCGGAGGAAAAAGAGGAAAAGGTACCACCAAAA
rJMSF012E23+ GGAGCAGAGGACAGTTCAGAGTTCATCTCGGAGGAAAAAGAGGAAAAGGTACCACCAAAA
rJMFF025P14+ GGAGCAGAGGACAGTTCAGAGTTCATCTCGGAGGAAAAAGAGGAAAAGGTACCACCAAAA
rJMFF037N07+ GGAGCAGAGGACAGTTCAGAGTTCATCTCGGAGGAAAAAGAGGAAAAGGTACCACCAAAA
rJMFF042L16+ GGAGCAGAGGACAGTTCAGAGTTCATCTCGGAGGAAAAAGAGGAAAAGGTACCACCAAAA
                      ____________________________________________________________
consensus GGAGCAGAGGACAGTTCAGAGTTCATCTCGGAGGAAAAAGAGGAAAAGGTACCACCAAAA
 
. : . : . : . : . : . :
rJMFF007E10+ CAAGAAATCGAGAGAGTTGAAATCGGTTCCCCTCAAGTGAACTGATTCCCGGGGATCGTG
rJMSF012E23+ CAAGAAATCGAGAGAGTTGAAATCGGTTCCCCTCAAGTGAACTGATTCCCGGGGATCGTG
rJMFF025P14+ CAAGAAATCGAGAGAGTTGAAATCGGTTCCCCTCAAGTGAACTGATTCCCGGGGATCGTG
rJMFF037N07+ CAAGAAATCGAGAGAGTTGAAATCGGTTCCCCTCAAGTGAACTGATTCCCGGGGATCGTG
rJMFF042L16+ CAAGAAATCGAGAGAGTTGAAATCGGTTCCCCTCAAGTGAACTGATTCCCGGGGATCGTG
                      ____________________________________________________________
consensus CAAGAAATCGAGAGAGTTGAAATCGGTTCCCCTCAAGTGAACTGATTCCCGGGGATCGTG
 
. : . : . : . : . : . :
rJMFF007E10+ CTTTCTGGTTTTCTTGCCCGTCCTCTCATAGTCGATGAGGTATTGTTTGGATATCCACAG
rJMSF012E23+ CTTTCTGGTTTTCTTGCCCGTCCTCTCATAGTCGATGAGGTATTGTTTGGATATCCACAG
rJMFF025P14+ CTTTCTGGTTTTCTTGCCCGTCCTCTCATAGTCGATGAGGTATTGTTTGGATATCCACAG
rJMFF037N07+ CTTTCTGGTTTTCTTGCCCGTCCTCTCATAGTCGATGAGGTATTGTTTGGATATCCACAG
rJMFF042L16+ CTTTCTGGTTTTCTTGCCCGTCCTCTCATAGTCGATGAGGTATTGTTTGGATATCCACAG
                      ____________________________________________________________
consensus CTTTCTGGTTTTCTTGCCCGTCCTCTCATAGTCGATGAGGTATTGTTTGGATATCCACAG
 
. : . : . : . : . : . :
rJMFF007E10+ AAGGCTGCGAGTTTACAGCAGCCTGTGGGACTTCATTGCTTGTTGAATTGAAAGGATGAT
rJMSF012E23+ AAGGCTGCGAGTTTACAGCAGCCTGTGGGACTTCATTGCTTGTTGAATTGAAAGGATGAT
rJMFF025P14+ AAGGCTGCGAGTTTACAGCAGCCTGTGGGACTTCATTGCTTGTTGAATTGAAAGGATGAT
rJMFF037N07+ AAGGCTGCGAGTTTACAGCAGCCTGTGGGACTTCATTGCTTGTTGAATTGAAAGGATGAT
rJMFF042L16+ AAGGCTGCGAGTTTACAGCAGCCTGTGGGACTTCATTGCTTGTTGAATTGAAAGGATGAT
                      ____________________________________________________________
consensus AAGGCTGCGAGTTTACAGCAGCCTGTGGGACTTCATTGCTTGTTGAATTGAAAGGATGAT
 
. : . : . : . : . : . :
rJMFF007E10+ TTGAATGTGTTGTGTGTGTGTGTGTGAATATTCTTGTTGTATGCTATTTTTAGTTCTTTT
rJMSF012E23+ TTGAATGTGTTGTGTGTGTGTGTGTGAATATTCTTGTTGTATGCTATTTTTAGTTCTTTT
rJMFF025P14+ TTGAATGTGTTGTGTGTGTGTGTGTGAATATTCTTGTTGTATGCTATTTTTAGTTCTTTT
rJMFF037N07+ TTGAATGTGT--TGTGTGTGTGTGTGAATATTCTTGTTGTATGCTATTTTTAGTTCTTTT
rJMFF042L16+ TTGAATGTGTTGTGTGTGTGTGTGTGAATATTCTTGTTGTATGCTATTTTTAGTTCTTTT
                      ____________________________________________________________
consensus TTGAATGTGTTGTGTGTGTGTGTGTGAATATTCTTGTTGTATGCTATTTTTAGTTCTTTT
 
. : . : . : . : . : . :
rJMFF007E10+ AATCAAAAC
rJMSF012E23+ AATCAAAACTTGAAAAATGTACAAGCTGTGCTGTGCTGTCATTGGATCATCATAGACAAG
rJMFF025P14+ AATCAAAACTTGAAAAATGTACAAGCTGTGCTGTGCTGTCATTGGATCATCATAGACAAG
rJMFF037N07+ AATCAAAACTTGAAAAATGTACAAGCTGTGCTGTGCTGTCATTGGATCATCATAGACAAG
rJMFF042L16+ AATCAAAACTTGAAAAATGTACAAGCTGTGCTGTGCTGTCATTGGATCATCATAGACAAG
                      ____________________________________________________________
consensus AATCAAAACTTGAAAAATGTACAAGCTGTGCTGTGCTGTCATTGGATCATCATAGACAAG
 
. : . : . : . : . : . :
rJMSF012E23+ AGGATTATTATATCTT
rJMFF025P14+ AGGATTATTATATCTTTTTAGGGAATTTGGGTTGAAATTAATGG-GAAAACACA
rJMFF037N07+ AGGATTATTATATCTTTTTAGGGAATTTGGGTTGAAATTAATGG-GAAAACACA
rJMFF042L16+ AGGATTATTATATCTTTTTAGGGAATTTGGGTTGAAATTAATGGTGAAAACACATTTGGT
                      ____________________________________________________________
consensus AGGATTATTATATCTTTTTAGGGAATTTGGGTTGAAATTAATGG-GAAAACACATTTGGT