Previous Contig 010242:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001H03Sequence651006878 (15)pir|T06458|T064580.002nucleolin homolog - garden pea>gb:PEAORF_1699719 Pisum sativum L. (clone na-481-610010242 (15)gb:AB087677_15247114e-15Nicotiana tabacum NNF1 mRNA for tobacco nucleolin, complete cds.
JMFF002D21Sequence673006878 (15)pir|T06458|T064580.002nucleolin homolog - garden pea>gb:PEAORF_1699719 Pisum sativum L. (clone na-481-826010242 (15)gb:AB087677_15247113e-37Nicotiana tabacum NNF1 mRNA for tobacco nucleolin, complete cds.
JMFF009C07Sequence686006878 (15)pir|T06458|T064580.002nucleolin homolog - garden pea>gb:PEAORF_1699719 Pisum sativum L. (clone na-481-724010242 (15)gb:AB087677_15247111e-28Nicotiana tabacum NNF1 mRNA for tobacco nucleolin, complete cds.
JMFF017K23Sequence649006878 (15)pir|T06458|T064580.002nucleolin homolog - garden pea>gb:PEAORF_1699719 Pisum sativum L. (clone na-481-378010242 (15)
JMFF019N23Sequence685006878 (15)pir|T06458|T064580.002nucleolin homolog - garden pea>gb:PEAORF_1699719 Pisum sativum L. (clone na-481-771010242 (15)gb:AB087677_15247118e-29Nicotiana tabacum NNF1 mRNA for tobacco nucleolin, complete cds.
JMFF030E21Sequence681010242 (15)gb:AB087677_15247113e-19Nicotiana tabacum NNF1 mRNA for tobacco nucleolin, complete cds.
JMFF032P10Sequence685006878 (15)717010242 (15)gb:AB087677_15247115e-25Nicotiana tabacum NNF1 mRNA for tobacco nucleolin, complete cds.
JMFF042K20Sequence631006878 (15)pir|T06458|T064580.002nucleolin homolog - garden pea>gb:PEAORF_1699719 Pisum sativum L. (clone na-481-620010242 (15)gb:OSJN00174_16962004e-08Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0058K23, complete seque
JMFF044J08Sequence642006878 (15)pir|T06458|T064580.002nucleolin homolog - garden pea>gb:PEAORF_1699719 Pisum sativum L. (clone na-481-631010242 (15)gb:AB087677_15247119e-13Nicotiana tabacum NNF1 mRNA for tobacco nucleolin, complete cds.
JMFF047P08Sequence640006878 (15)pir|T06458|T064580.002nucleolin homolog - garden pea>gb:PEAORF_1699719 Pisum sativum L. (clone na-481-572010242 (15)gb:AB087677_15247112e-12Nicotiana tabacum NNF1 mRNA for tobacco nucleolin, complete cds.
JMSF002B24Sequence264006878 (15)pir|T06458|T064587e-04nucleolin homolog - garden pea>gb:PEAORF_1699719 Pisum sativum L. (clone na-481-771010242 (15)gb:AB087677_15247119e-46Nicotiana tabacum NNF1 mRNA for tobacco nucleolin, complete cds.
JMSF015C24Sequence227018915793010242 (15)gb:AB087677_15247111e-18Nicotiana tabacum NNF1 mRNA for tobacco nucleolin, complete cds.
JMSF016G15Sequence452006878 (15)763010242 (15)gb:AB087677_15247112e-42Nicotiana tabacum NNF1 mRNA for tobacco nucleolin, complete cds.
JMSF020I02Sequence736006878 (15)pir|T06458|T064580.002nucleolin homolog - garden pea>gb:PEAORF_1699719 Pisum sativum L. (clone na-481-738010242 (15)gb:AB087677_15247118e-15Nicotiana tabacum NNF1 mRNA for tobacco nucleolin, complete cds.
JMSF033G08Sequence739006878 (15)pir|T06458|T064580.002nucleolin homolog - garden pea>gb:PEAORF_1699719 Pisum sativum L. (clone na-481-791010242 (15)gb:AB087677_15247114e-37Nicotiana tabacum NNF1 mRNA for tobacco nucleolin, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF015C24+ CTGTGATGATGCTTCTG
                      ____________________________________________________________
consensus CTGTGATGATGCTTCTG
 
. : . : . : . : . : . :
rJMSF015C24+ TCTNGTGCTGGACCTGGTTGGNCAGACTGTTATGTTCCAGTTCATGGTTCTTGAAGGTGT
                      ____________________________________________________________
consensus TCTNGTGCTGGACCTGGTTGGNCAGACTGTTATGTTCCAGTTCATGGTTCTTGAAGGTGT
 
. : . : . : . : . : . :
rJMSF015C24+ CTTCATGCATTAATCATGTCTTCTTTATAGCTGTTTACAGCAAGACTGTACCAATCTCAT
                      ____________________________________________________________
consensus CTTCATGCATTAATCATGTCTTCTTTATAGCTGTTTACAGCAAGACTGTACCAATCTCAT
 
. : . : . : . : . : . :
rJMSF015C24+ ATAAGGCACAATCACAAGATGAAGAAGCCCCTGCTCACTTAATCAATAGACAACGATTTT
                      ____________________________________________________________
consensus ATAAGGCACAATCACAAGATGAAGAAGCCCCTGCTCACTTAATCAATAGACAACGATTTT
 
. : . : . : . : . : . :
rJMSF015C24+ TAACTGTTGTCTTTTCTAGAAAAGACAACGGTTAAAAATCGTTGTCTATGTGCGTGACTT
                      ____________________________________________________________
consensus TAACTGTTGTCTTTTCTAGAAAAGACAACGGTTAAAAATCGTTGTCTATGTGCGTGACTT
 
. : . : . : . : . : . :
rJMSF015C24+ TTAACCGTTTCCTTGTTTAACAGTGACTGAGTTGGATTATTTGTTGATGTGTGTACAAAT
                      ____________________________________________________________
consensus TTAACCGTTTCCTTGTTTAACAGTGACTGAGTTGGATTATTTGTTGATGTGTGTACAAAT
 
. : . : . : . : . : . :
rJMSF015C24+ CTGTTGCAGGCTCTTCAACTTAATGGCCAACAGTTGTTGGGCCGAGAAGTGACTCTTGAC
rJMSF002B24+ AGGCTCTTGAACTTAATGGTCAAGATTTGTTGGGCCGAGATGTGAAGCTTGAC
rJMSF016G15+ AGGCTCTTGAACTTAATGGTCAAGATTTGTTGGGCCGAGATGTGAAGCTTGAC
rJMSF033G08+ TTAATGGTCCAGATTTGNTGGGCCGAGATGTGAAGCTTGAC
rJMFF002D21+ AACTTAATGGTCAAGATTTGTTGGNCCGAGATGTGAAGCTTGNC
                      ____________________________________________________________
consensus CTGTTGCAGGCTCTTGAACTTAATGGTCAAGATTTGTTGGGCCGAGATGTGAAGCTTGAC
 
. : . : . : . : . : . :
rJMSF015C24+ CTTGCTAAAGAGGGGGGAGCTTATACTCTGAATGCTGGGAAATTTGATAACTCCTTCCAG
rJMSF002B24+ CTTGCTAAAGAGAGGGGAGCTTATACTCCAAATAGTGGGGCATTTGATAACTCCTCACAG
rJMSF016G15+ CTTGCTAAAGAGAGGGGAGCTTATACTCCAAATAGTGGGGCATTTGATAACTCCTCACAG
rJMSF033G08+ CTTGCTAAAGAGAGGGGAGCTTATACTCCAAATAGTGGGGCATTTGATAACTCCTCACAG
rJMFF002D21+ NTTGCTAAAGAGAGGGGAGCTTATACTCCAAATAGTGGGGCATTTGATAACTCTTCACAG
rJMSF020I02+ TCCTCACAG
rJMFF009C07+ CAG
rJMFF019N23+ TCACAG
                      ____________________________________________________________
consensus CTTGCTAAAGAGAGGGGAGCTTATACTCCAAATAGTGGGGCATTTGATAACTCCTCACAG
 
. : . : . : . : . : . :
rJMSF015C24+ TGGCAGTTCA-AGGGTGGAGGTGAAAGTACAACTGTGTTTGTTAAGGGGTTTGACAAGAA
rJMSF002B24+ AGGCAGAGCA-GGGGTGGAGGTGAAAGTACAACTGTGTTTGTTAGGGGTTTTGACAAGAA
rJMSF016G15+ AGGCAGAGCA-GGGGTGGAGGTGAAAGTACAACTGTGTTTGTTAGGGGTTTTGACAAGAA
rJMSF033G08+ AGGCAGAGCA-GGGGTGGAGGTGAAAGTACAACTGTGTTTGTTAGGGGTTTTGACAAGAA
rJMFF002D21+ AGGCAGAGCA-GGGGTGGAGGTGAAAGTACAACTGTGTTTGTTAGGGGTTTTGACAAGAA
rJMSF020I02+ AGGCAGAGCA-GGGGTGGAGGTGAAAGTACAACTGTGTTTGTTAGGGG-TTTGACAAGAA
rJMFF009C07+ AGGCAGAGCAGGGGGTGGAGGTGAAAGTACAACTGTGTTTGTTAGGGGTTTTGACAAGAA
rJMFF019N23+ AGGCAGAGCA-GGGGTGGAGGTGAAAGTACAACTGTGTTTGTTAGGGGTTTTGACAAGAA
rJMFF032P10+ GTTAGGGGTTTTGACAAGAA
                      ____________________________________________________________
consensus AGGCAGAGCA-GGGGTGGAGGTGAAAGTACAACTGTGTTTGTTAGGGGTTTTGACAAGAA
 
. : . : . : . : . : . :
rJMSF015C24+ TGACCTTGAAGATAAGATCAGGAGTTCTCTTGAGGATCATTTTAGTTGTTGTGGAGAGAT
rJMSF002B24+ TGATACTGAAGACAATATCAGGAGTGCTCTTGAGGGTCATTTTGGTTCTTGTGGAGAGAT
rJMSF016G15+ TGATACTGAAGACAATATCAGGAGTGCTCTTGAGGGTCATTTTGGTTCTTGTGGAGAGAT
rJMSF033G08+ TGATACTGAAGACAATATCAGGAGTGCTCTTGAGGGTCATTTTGGTTCTTGTGGAGAGAT
rJMFF002D21+ TGATACTGAAGACAATATCAGGAGTGCTCTTGAGGGTCATTTTGGTTCTTGTGGAGAGAT
rJMSF020I02+ TGATACTGAAGACAATATCAGGAGTGCTCTTGAGGGTCATTTTGGTTCTTGTG--GAGAT
rJMFF001H03+ TTGTGGAGAGAT
rJMFF009C07+ TGATACTGAAGACAATATCAGGAGTGCTCTTGAGGGTCATTTTGGTTCTTGTGGAGAGAT
rJMFF047P08+ AGAGAT
rJMFF019N23+ TGATACTGAAGACAATATCAGGAGTGCTCTTGAGGGTCATTTTGGTTCTTGTGGAGAGAT
rJMFF030E21+ TATCAGGAGTGCTCTTGAGGGTCATTTTGGTTCTTGTGGAGAGAT
rJMFF032P10+ TGATACTGAAGACAATATCAGGAGTGCTCTTGAGGGTCATTTTGGTTCTTGTGGAGAGAT
                      ____________________________________________________________
consensus TGATACTGAAGACAATATCAGGAGTGCTCTTGAGGGTCATTTTGGTTCTTGTGGAGAGAT
 
. : . : . : . : . : . :
rJMSF015C24+ TAAAGGTA
rJMSF002B24+ TAAAGGTACCAGAATCCCAACAGACCCGGAAGGGTACATTAAAGGGATGGCTTATATTGA
rJMSF016G15+ TAAAGGTACCAGAATCCCAACAGACCCGGAAGGGTACATTAAAGGGATGGCTTATATTGA
rJMSF033G08+ TAAAGGTACCAGAATCCCAACAGACCCGGAAGGGTACATTAAAGGGATGGCTTATATTGA
rJMFF002D21+ TAAAGGTACCAGAATCCCAACAGACCCGGAAGGGTACATTAAAGGGATGGCTTATATTGA
rJMSF020I02+ TAAAGGTACCAGAATCCCAACAGACCCGGAAGGGTACATTAAAGGGATGGCTTATATTGA
rJMFF001H03+ TAAAGGTACCAGAATCCCAACAGACCCGGAAGGGTACATTAAAGGGATGGCTTATATTGA
rJMFF009C07+ TAAAGGTACCAGAATCCCAACAGACCCGGAAGGGTACATTAAAGGGATGGCTTATATTGA
rJMFF044J08+ CAGAATCCCAACAGACCCGGAAGGGTACATTAAAGGGATGGCTTATATTGA
rJMFF047P08+ TAAAGGTACCAGAATCCCAACAGACCCGGAAGGGTACATTAAAGGGATGGCTTATATTGA
rJMFF019N23+ TAAAGGTACCAGAATCCCAACAGACCCGGAAGGGTACATTAAAGGGATGGCTTATATTGA
rJMFF030E21+ TAAAGGTACCAGAATCCCAACAGACCCGGAAGGGTACATTAAAGGGATGGCTTATATTGA
rJMFF032P10+ TAAAGGTACCAGAATCCCAACAGACCCGGAAGGGTACATTAAAGGGATGGCTTATATTGA
rJMFF042K20+ TAAAGGGATGGCTTATATTGA
                      ____________________________________________________________
consensus TAAAGGTACCAGAATCCCAACAGACCCGGAAGGGTACATTAAAGGGATGGCTTATATTGA
 
. : . : . : . : . : . :
rJMSF002B24+ GTTCGCGGACAATGATGCAATGAGCAAGGCTCTTGAGCTCAACAACTCCCAACTTGGGCA
rJMSF016G15+ GTTCGCGGACAATGATGCAATGAGCAAGGCTCTTGAGCTCAACAACTCCCAACTTGGGCA
rJMSF033G08+ GTTCGCGGACAATGATGCAATGAGCAAGGCTCTTGAGCTCAACAACTCCCAACTTGGGCA
rJMFF002D21+ GTTCGCGGACAATGATGCAATGAGCAAGGCTCTTGAGCTCAACAACTCCCAACTTGGGCA
rJMSF020I02+ GTTCGCGGACAATGATGCAATGAGCAAGGCTCTTGAGCTCAACAACTCCCAACTTGGGCA
rJMFF001H03+ GTTCGCGGACAGTGATGCAATGAGCAAGGCTCTTGAGCTCAACAACTCCCAACTTGGGCA
rJMFF009C07+ GTTCGCGGACAGTGATGCAATGAGCAAGGCTCTTGAGCTCAACAACTCCCAACTTGGGCA
rJMFF044J08+ GTTCGCGGACAGTGATGCAATGAGCAAGGCTCTTGAGCTCAACAACTCCCAACTTGGGCA
rJMFF047P08+ GTTCGCGGACAATGATGCAATGAGCAAGGCTCTTGAGCTCAACAACTCCCAACTTGGGCA
rJMFF019N23+ GTTCGCGGACAATGATGCAATGAGCAAGGCTCTTGAGCTCAACAACTCCCAACTTGGGCA
rJMFF030E21+ GTTCGCGGACAATGATGCAATGAGCAAGGCTCTTGAGCTCAACAACTCCCAACTTGGGCA
rJMFF032P10+ GTTCGCGGACAATGATGCAATGAGCAAGGCTCTTGAGCTCAACAACTCCCAACTTGGGCA
rJMFF042K20+ GTTCGCGGACAATGATGCAATGAGCAAGGCTCTTGAGCTCAACAACTCCCAACTTGGGCA
                      ____________________________________________________________
consensus GTTCGCGGACAATGATGCAATGAGCAAGGCTCTTGAGCTCAACAACTCCCAACTTGGGCA
 
. : . : . : . : . : . :
rJMSF002B24+ CAGCAGCTTGTATGTTGATGAAGCTAAGCCAAGAAATGATAGTCGTGGTGAGAGTGGAGG
rJMSF016G15+ CAGCAGCTTGTATGTTGATGAAGCTAAGCCAAGAAATGATNGTCGTGGTGAGAGTGGAGG
rJMSF033G08+ CAGCAGCTTGTATGTTGATGAAGCTAAGCCAAGAAATGATAGTCGTGGTGAGAGTGGAGG
rJMFF002D21+ CAGCAGCTTGTATGTTGATGAAGCTAAGCCAAGAAATGATAGTCGTGGTGAGAGCGGAGG
rJMSF020I02+ CAGCAGCTTGTATGTTGATGAAGCTAAGCCAAGAAATGATAGTCGTGGTGAGAGTGGAGG
rJMFF001H03+ CAGCAGCTTGTATGTTGATGAAGCTAAGCCAAGAAATGATAGTCGTGGTGAGAGTGGAGG
rJMFF009C07+ CAGCAGCTTGTATGTTGATGAAGCTAAGCCAAGAAATGATAGTCGTGGTGAGAGTGGAGG
rJMFF044J08+ CAGCAGCTTGTATGTTGATGAAGCTAAGCCAAGAAATGATAGTCGTGGTGAGAGTGGAGG
rJMFF047P08+ CAGCAGCTTGTATGTTGATGAAGCTAAGCCAAGAAATNATAGTCGTGGTGAGAGTGGAGG
rJMFF019N23+ CAGCAGCTTGTATGTTGATGAAGCTAAGCCAAGAAATGATAGTCGTGGTGAGAGTGGAGG
rJMFF030E21+ CAGCAGCTTGTATGTTGATGAAGCTAAGCCAAGAAATGATAGTCGTGGTGAGAGTGGAGG
rJMFF032P10+ CAGCAGCTTGTATGTTGATGAAGCTAAGCCAAGAAATGATAGTCGTGGTGAGAGTGGAGG
rJMFF042K20+ CAGCAGCTTGTATGTTGATGAAGCTAAGCCAAGAAATGATAGTCGTGGTGAGAGTGGAGG
                      ____________________________________________________________
consensus CAGCAGCTTGTATGTTGATGAAGCTAAGCCAAGAAATGATAGTCGTGGTGAGAGTGGAGG
 
. : . : . : . : . : . :
rJMSF002B24+ CAGAGGTGGCAGGTTTGGTGGTGGTAGGAGCGGTGGTAGGGACAGCGGTGGCAGGTTTGG
rJMSF016G15+ CAGAGGTGGCAGGTTTGGTGGTGGTAGGAGCGGTGGTAGGGACAGCGGTGGCAGGTTTGG
rJMSF033G08+ CAGAGGTGGCAGGTTTGGTGGTGGTAGGAGCGGTGGTAGGGACAGCGGTGGCAGGTTTGG
rJMFF002D21+ CAGAGGTGGCAGGTTTGGTGGTGGTAGGAGCGGTGGTAGGGACAGCGGTGGCAGGTTTGG
rJMSF020I02+ CAGAGGTGGCAGGTTTGGTGGTGGTAGGAGCGGTGGTAGGGACAGCGGTGGCAGGTTTGG
rJMFF001H03+ CAGAGGTGGCAGGTTTGGTGGTGGTAGGAGCGGTGGTAGGGACAGCGGTGGCAGGTTTGG
rJMFF009C07+ CAGAGGTGGCAGGTTTGGTGGTGGTAGGAGCGGTGGTAGGGACAGCGGTGGCAGGTTTGG
rJMFF044J08+ CAGAGGTGGCAGGTTTGGTGGTGGTAGGAGCGGTGGTAGGGACAGCGGTGGCAGGTTTGG
rJMFF047P08+ CAGAGGTGGCAGGTTTGGTGGTGGTAGGAGCGGTGGTAGGGACAGCGGTGGCAGGTTTGG
rJMFF019N23+ CAGAGGTGGCAGGTTTGGTGGTGGTAGGAGCGGTGGTAGGGACAGCGGTGGCAGGTTTGG
rJMFF030E21+ CAGAGGTGGCAGGTTTGGTGGTGGTAGGAGCGGTGGTAGGGACAGCGGTGGCAGGTTTGG
rJMFF032P10+ CAGAGGTGGCAGGTTTGGTGGTGGTAGGAGCGGTGGTAGGGACAGCGGTGGCAGGTTTGG
rJMFF042K20+ CAGAGGTGGCAGGTTTGGTGGTGGTAGGAGCGGTGGTAGGGACAGCGGTGGCAGGTTTGG
                      ____________________________________________________________
consensus CAGAGGTGGCAGGTTTGGTGGTGGTAGGAGCGGTGGTAGGGACAGCGGTGGCAGGTTTGG
 
. : . : . : . : . : . :
rJMSF002B24+ AGGAAGGGGAGGTGGTAGACGTGGTGGTGGTGGTGGTAGGTTTGGAAGTGGTGGTGGTGG
rJMSF016G15+ AGGAAGGGGAGGTGGTAGACGTGGTGGTGGTGGTGGTAGGTTTGGAAGTGGTGGTGGTGG
rJMSF033G08+ AGGAAGGGGAGGTGGTAGACGTGGTGGTGGTGGTGGTAGGTTTGGAAGTGGTGGTGGTGG
rJMFF002D21+ AGGAAGGGGAGGTGGTAGACGTGGTGGTGGTGGTGGTAGGTTTGGAAGTGGTGGTGGTGG
rJMSF020I02+ AGGAAGGGGAGGTGGTAGACGTGGTGGTGGTGGTGGTAGGTTTGGAAGTGGTGGTGGTGG
rJMFF001H03+ AGGAAGGGGAGGTGGTAGACGTGGTGGTGGTGGTGGTAGGTTTGGAAGTGGTGGTGGTGG
rJMFF009C07+ AGGAAGGGGAGGTGGTAGACGTGGTGGTGGTGGTGGTAGGTTTGGAAGTGGTGGTGGTGG
rJMFF044J08+ AGGAAGGGGAGGTGGTAGACGTGGTGGTGGTGGTGGTAGGTTTGGAAGTGGTGGTGGTGG
rJMFF047P08+ AGGAAGGGGAGGTGGTAGACGTGGTGGTGGTGGTGGTAGGTTTGGAAGTGGTGGTGGTGG
rJMFF019N23+ AGGAAGGGGAGGTGGTAGACGTGGTGGTGGTGGTGGTAGGTTTGGAAGTGGTGGTGGTGG
rJMFF030E21+ AGGAAGGGGAGGTGGTAGACGTGGTGGTGGTGGTGGTAGGTTTGGAAGTGGTGGTGGTGG
rJMFF032P10+ AGGAAGGGGAGGTGGTAGACGTGGTGGTGGTGGTGGTAGGTTTGGAAGTGGTGGTGGTGG
rJMFF017K23+ GGTGGTGGTGGTAGCTTTGGNAGTGGCGGTGGTGG
rJMFF042K20+ AGGAAGGGGAGGTGGTAGACGTGGTGGTGGTGGTGGTAGGTTTGGAAGTGGTGGTGGTGG
                      ____________________________________________________________
consensus AGGAAGGGGAGGTGGTAGACGTGGTGGTGGTGGTGGTAGGTTTGGAAGTGGTGGTGGTGG
 
. : . : . : . : . : . :
rJMSF002B24+ CAGGTTTGGAGGCAGTGGCAGAGGAGGTGGCCGAACTCCTGGCAAGCCAAGCATGACTTT
rJMSF016G15+ CAGGTTTGGAGGCAGTGGCAGAGGAGGTGGCCGAACTCCTGGCAAGCCAAGCATGACTTT
rJMSF033G08+ CAGGTTTGGAGGCAGTGGCAGAGGAGGTGGCCGAACTCCTGGCAAGCCAAGCATGACTTT
rJMFF002D21+ CAGGTTTGGAGGCAGTGGCAGAGGAGGTGGCCGAACTCCTGGCAAGCCAAGCATGACTTT
rJMSF020I02+ CAGGTTTGGAGGCAGTGGCAGAGGAGGTGGCCGAACTCCTGGCAAGCCAAGCATGACTTT
rJMFF001H03+ CAGGTTTGGAGGCAGTGGCAGAGGAGGTGGCCGAACTCCTGGCAAGCCAAGCATGACTTT
rJMFF009C07+ CAGGTTTGGAGGCAGTGGCAGAGGAGGTGGCCGAACTCCTGGCAAGCCAAGCATGACTTT
rJMFF044J08+ CAGGTTTGGAGGCAGTGGCAGAGGAGGTGGCCGAACTCCTGGCAAGCCAAGCATGACTTT
rJMFF047P08+ CAGGTTTGGAGGCAGTGGCAGAGGAGGTGGCCGAACTCCTGGCAAGCCAAGCATGACTTT
rJMFF019N23+ CAGGTTTGGAGGCAGTGGCAGAGGAGGTGGCCGAACTCCTGGCAAGCCAAGCATGACTTT
rJMFF030E21+ CAGGTTTGGAGGCAGTGGCAGAGGAGGTGGCCGAACTCCTGGCAAGCCAAGCATGACTTT
rJMFF032P10+ CAGGTTTGGAGGCAGTGGCAGAGGAGGTGGCCGAACTCCTGGCAAGCCAAGCATGACTTT
rJMFF017K23+ CAGGTTTGGAGNCAGTGGCNGAGGAGGTGCCCGAACTCCTGGCAAGCCAAGCATGACTTT
rJMFF042K20+ CAGGTTTGGAGGCAGTGGCAGAGGAGGTGGCCGAACTCCTGGCAAGCCAAGCATGACTTT
                      ____________________________________________________________
consensus CAGGTTTGGAGGCAGTGGCAGAGGAGGTGGCCGAACTCCTGGCAAGCCAAGCATGACTTT
 
. : . : . : . : . : . :
rJMSF002B24+ TTCTTCTGGTAAGAAGACAACTTTTGATGATTGAGGAGTAGGCTGTGAAGCTCGGCATCA
rJMSF016G15+ TTCTTCTCGTAAGAAGACAACTTTTGATGATTGAGGAGTAGGCTGTGAAGCTCGGCATCA
rJMSF033G08+ TTCTTCTGGTAAGAAGACAACTTTTGATGATTGAGGAGTAGGCTGTGAAGCTCGGCATCA
rJMFF002D21+ TTCTTCTGGTAAGAAGACAACTTTTGATGATTGAGGAGTAGGCTGTGAAGCTCGGCATCA
rJMSF020I02+ TTCTTCTGGTAAGAAGACAACTTTTGATGATTGAGGAGTAGGCTGTGAAGCTCGGCATCA
rJMFF001H03+ TTCTTCTGGTAAGAAGACAACTTTTGATGATTGAGGAGTAGGCTGTGAAGCTCGGCATCA
rJMFF009C07+ TTCTTCTGGTAAGAAGACAACTTTTGATGATTGAGGAGTAGGCTGTGAAGCTCGGCATCA
rJMFF044J08+ TTCTTCTGGTAAGAAGACAACTTTTGATGATTGAGGAGTAGGCTGTGAAGCTCGGCATCA
rJMFF047P08+ TTCTTCTGGTAAGAAGACAACTTTTGATGATTGAGGAGTAGGCTGTGAAGCTCGGCATCA
rJMFF019N23+ TTCTTCTGGTAAGAAGACAACTTTTGATGATTGAGGAGTAGGCTGTGAAGCTCGGCATCA
rJMFF030E21+ TTCTTCTGGTAAGAAGACAACTTTTGATGATTGAGGAGTAGGCTGTGAAGCTCGGCATCA
rJMFF032P10+ TTCTTCTGGTAAGAAGACAACTTTTGATGATTGAGGAGTAGGCTGTGAAGCTCGGCATCA
rJMFF017K23+ TTCTTCTGGTAAGAAGACAACTTTTGATGATTGAGGAGTAGGCTGTGAAGCTCGGCATCA
rJMFF042K20+ TTCTTCTGGTAAGAAGACAACTTTTGATGATTGAGGAGTAGGCTGTGAAGCTCGGCATCA
                      ____________________________________________________________
consensus TTCTTCTGGTAAGAAGACAACTTTTGATGATTGAGGAGTAGGCTGTGAAGCTCGGCATCA
 
. : . : . : . : . : . :
rJMSF002B24+ GGCAGCAGCCAGAATGTTTGCCATTTTTGTTTATTTTAAGACTGAGTTCTAGTTTATTTC
rJMSF016G15+ GGCAGCAGCCAGAATGTTTNCCATTTTTGTTTATTTTAAGACTGAGTTCTAGTTTATTTC
rJMSF033G08+ GGCAGCAGCCAGAATGTTTGCCATTTTTGTTTATTTTAAGACTGAGTTCTAGTTTATTTC
rJMFF002D21+ GGCAGCAGCCAGAATGTTTGCCATTTTTGTTTATTTTAAGACTGAGTTCTAGTTTATTTC
rJMSF020I02+ GGCAGCAGCCAGAATGTTTGCCATTTTTGTTTATTTTAAGACTGAGTTCTAGTTTATTTC
rJMFF001H03+ GGCAGCAGCCAGAATGTTTGCCATTTTTGTTTATTTTAAGACTGAGTTCTAGTTTATTTC
rJMFF009C07+ GGCAGCAGCCAGAATGTTTGCCATTTTTGTTTATTTTAAGACTGAGTTCTAGTTTATTTC
rJMFF044J08+ GGCAGCAGCCAGAATGTTTGCCATTTTTGTTTATTTTAAGACTGAGTTCTAGTTTATTTC
rJMFF047P08+ GGCAGCAGCCAGAATGTTTGCCATTTTTGTTTATTTTAAGACTGAGTTCTAGTTTATTTC
rJMFF019N23+ GGCAGCAGCCAGAATGTTTGCCATTTTTGTTTATTTTAAGACTGAGTTCTAGTTTATTTC
rJMFF030E21+ GGCAGCAGCCAGAATGTTTGCCATTTTTGTTTATTTTAAGACTGAGTTCTAGTTTATTTC
rJMFF032P10+ GGCAGCAGCCAGAATGTTTGCCATTTTTGTTTATTTTAAGACTGAGTTCTAGTTTATTTC
rJMFF017K23+ GGCAGCAGCCAGAATGTTTGCCATTTTTGTTTATTTTAAGACTGAGTTNTAGTTTATTTC
rJMFF042K20+ GGCAGCAGCCAGAATGTTTGCCATTTTTGTTTATTTTAAGACTGAGTTCTAGTTTATTTC
                      ____________________________________________________________
consensus GGCAGCAGCCAGAATGTTTGCCATTTTTGTTTATTTTAAGACTGAGTTCTAGTTTATTTC
 
. : . : . : . : . : . :
rJMSF002B24+ TGAA-C
rJMSF016G15+ TGAACCATGTGACCTATGATAGTTTGTATTTTGT
rJMSF033G08+ TGAA-CATGTGACCTATGATAGTTTGTATTTTGTTTATCCATGTGGGGATCTATTTTGTC
rJMFF002D21+ TGAA-CATGTGACCTATGATAGTTTGTATTTTGTTTATCCATGTGGGGATCTATTTTGTC
rJMSF020I02+ TGAA-CATGTGACCTATGATAGTTTGTATTTTGTTTATCCATGTGGGGATCTATTTTGTC
rJMFF001H03+ TGAA-CATGTGACCTATGATAGTTTGTATTTTGTTTATCCATGTGGGGATCTATTTTGTC
rJMFF009C07+ TGAA-CATGTGACCTATGATAGTTTGTATTTTGTTTATCCATGTGGGGATCTATTTTGTC
rJMFF044J08+ TGAA-CATGTGACCTATGATAGTTTGTATTTTGTTTATCCATGTGGGGATCTATTTTGTC
rJMFF047P08+ TGAA-CATGTGACCTATGATAGTTTGTATTTTGTTTATCCATGTGGGGATCTATTTTGTC
rJMFF019N23+ TGAA-CATGTGACCTATGATAGTTTGTATTTTGTTTATCCATGTGGGGATCTATTTTGTC
rJMFF030E21+ TGAA-CATGTGACCTATGATAGTTTGTATTTTGTTTATCCATGTGGGGATCTATTTTGTC
rJMFF032P10+ TGAA-CATGTGACCTATGATAGTTTGTATTTTGTTTATCCATGTGGGGATCTATTTTGTC
rJMFF017K23+ TGAA-CATGTGACCTATGATAGTTTGTATTTTGTTTATCCATGTGGGGATCTATTTTGTC
rJMFF042K20+ TGAA-CATGTGACCTATGATAGTTTGTATTTTGTTTATCCATGTGGGGATCTATTTTGTC
                      ____________________________________________________________
consensus TGAA-CATGTGACCTATGATAGTTTGTATTTTGTTTATCCATGTGGGGATCTATTTTGTC
 
. : . : . : . : . : . :
rJMSF033G08+ GACAATAGTTTGTTTGTTTGTTTACCTACATT
rJMFF002D21+ GACAATAGTTTGTTTGTTTGTTTACCTACATTATTTATTTATCCTCTACCGGCACCAACT
rJMSF020I02+ GACAATAGTTTGTTTGTTTGTTTACCTACATTATTTATTTATCCTCTACCGGCACCAACT
rJMFF001H03+ GACAATAGTTTGTTTGTTTGTTTACCTACATTATTTATTTA-CCTCTACCGGCACCAACT
rJMFF009C07+ GACAATAGTTTGTTTGTTTGTTTACCTACATTATTTATTTATCCTCTACCGGCACCAACT
rJMFF044J08+ GACAATAGTTTGTTTGTTTGTTTACCTACATTATTTATTTATCCTCTACCGGCACCAACT
rJMFF047P08+ GACAATAGTTTGTTTGTTTGTTTACC
rJMFF019N23+ GACAATAGTTTGTTTGTTTGTTTACCTACATTATTTATTTATCCTCTACCGGCACCAACT
rJMFF030E21+ GACAATAGTTTGTTTGTTTGTTTACCTACATTATTTATTTATCCTCTACCGGCACCAACT
rJMFF032P10+ GACAATAGTTTGTTTGTTTGTTTACCTACATTATTTATTTATCCTCTACCGGCACCAACT
rJMFF017K23+ GACAATAGTTTGTTTGTTTGTTTACCTACATTATTTATTTATCCTCTACCGGCACCAACT
rJMFF042K20+ GACAATAGTTTGTTTGTTTGTTTACCTACATTATTTATTTATCCTCTACCGGCACCAACT
                      ____________________________________________________________
consensus GACAATAGTTTGTTTGTTTGTTTACCTACATTATTTATTTATCCTCTACCGGCACCAACT
 
. : . : . : . : . : . :
rJMFF002D21+ CA
rJMSF020I02+ CATATAAAGT
rJMFF009C07+ CA
rJMFF044J08+ CATATAAAGTTGCCAAA
rJMFF019N23+ CATATAAAGTTGCCAAA
rJMFF030E21+ CATATAAAGTTGCCAAATTCTGTCTTTTACATTTTAT
rJMFF032P10+ CATATAAAGTTGCCAAATTCTGTCTTTTACATTTTATC
rJMFF017K23+ CATATAAAGTTGCCAAATTCTGTCTTNTACATTTTATC
rJMFF042K20+ CATATAAAGTTGCCAAATTCTGTCTTTTACATTTTATCTATAAAATCCCCTCCTACAGGC
                      ____________________________________________________________
consensus CATATAAAGTTGCCAAATTCTGTCTTTTACATTTTATCTATAAAATCCCCTCCTACAGGC