Previous Contig 010239:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017O11Sequence536010239 (14)gb:AY085253_15703250.008Arabidopsis thaliana clone 141890 mRNA, complete sequence.807010239 (14)pir|T08924|T089248e-72hypothetical protein T15N24.30 - Arabidopsis thaliana>gb:ATCHRIV65_1546539 Arabi
JMFF042K10Sequence659010239 (14)gb:AY085253_15703259e-19Arabidopsis thaliana clone 141890 mRNA, complete sequence.602010239 (14)pir|T08924|T089249e-47hypothetical protein T15N24.30 - Arabidopsis thaliana>gb:ATCHRIV65_1546539 Arabi
JMFF043M18Sequence633010239 (14)gb:AY085253_15703259e-18Arabidopsis thaliana clone 141890 mRNA, complete sequence.577010239 (14)pir|T08924|T089242e-42hypothetical protein T15N24.30 - Arabidopsis thaliana>gb:ATCHRIV65_1546539 Arabi
JMSF035A12Sequence726010239 (14)gb:AY085253_15703255e-35Arabidopsis thaliana clone 141890 mRNA, complete sequence.774010239 (14)pir|T08924|T089242e-71hypothetical protein T15N24.30 - Arabidopsis thaliana>gb:ATCHRIV65_1546539 Arabi
JMSF036D11Sequence690010239 (14)gb:AY085253_15703254e-32Arabidopsis thaliana clone 141890 mRNA, complete sequence.660010239 (14)pir|T08924|T089249e-65hypothetical protein T15N24.30 - Arabidopsis thaliana>gb:ATCHRIV65_1546539 Arabi
JMSF044D05Sequence848010239 (14)gb:AY085253_15703252e-64Arabidopsis thaliana clone 141890 mRNA, complete sequence.707010239 (14)pir|T08924|T089243e-70hypothetical protein T15N24.30 - Arabidopsis thaliana>gb:ATCHRIV65_1546539 Arabi
JMSF048G22Sequence694010239 (14)gb:AY085253_15703252e-32Arabidopsis thaliana clone 141890 mRNA, complete sequence.775010239 (14)pir|T08924|T089247e-72hypothetical protein T15N24.30 - Arabidopsis thaliana>gb:ATCHRIV65_1546539 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF017O11- ACAGTAATCGAATATCATCTGTTGCTGGTTTCCTAATCT
JMFF043M18- ACAGTAATCGAATATCATCTGTTGCTGGTTTCCTAATCT
JMFF042K10- ACAGTAATCGAATATCATCTGTTGCTGGTTTCCTAATCT
                      ____________________________________________________________
consensus ACAGTAATCGAATATCATCTGTTGCTGGTTTCCTAATCT
 
. : . : . : . : . : . :
JMFF017O11- TAGGTGATGTGTGTTCCAAGAACCAGTTACTTTCAGCCTTTGCTTACATACTAAACAAAC
JMFF043M18- TAAGTGATGTGTGTTCCAAGAACCAGTTACTTTCAGCCTTTGCTTACATACTAAACAAAC
JMFF042K10- TAGGTGATGTGTGTTCCAAGAACCAGTTACTTTCAGCCTTTGCTTACATACTAAACAAAC
JMSF036D11- AGCCTTTGCTTACATACTAAACAAAC
JMSF035A12- GTGATGTGTGTTCCAAGAACCAGTTACTTTCAGCCTTTGCTTACATACTAAACAAAC
JMSF048G22- AGCCTTTGCTTACATACTAAACAAAC
                      ____________________________________________________________
consensus TAGGTGATGTGTGTTCCAAGAACCAGTTACTTTCAGCCTTTGCTTACATACTAAACAAAC
 
. : . : . : . : . : . :
JMFF017O11- CAAGAAATGGGGGGAAGTTAGGCCAACGGTTATAGTTTCAACTCCTTTCTTCAATTCAAT
JMFF043M18- CAAGAAATGGGGGGAAGTTAGGCCAACGGTTATAGTTTCAACTCCTTTCTTCAATTCAAT
JMFF042K10- CAAGAAATGGGGGGAAGTTAGGCCAACGGTTATAGTTTCAACTCCTTTCTTCAATTCAAT
JMSF036D11- CAAGAAAT-GGGGGAAGTTAGGCCAACGGTTATAGTTTCAACTCCTTTCTTCAATTCAAT
JMSF035A12- CAAGAAATGGGGGGAAGTTAGGCCAACGGTTATAGTTTCAACTCCTTTCTTCAATTCAAT
JMSF048G22- CAAGAAATGGGGGGAAGTTAGGCCAACGGTTATAGTTTCAACTCCTTTCTTCAATTCAAT
                      ____________________________________________________________
consensus CAAGAAATGGGGGGAAGTTAGGCCAACGGTTATAGTTTCAACTCCTTTCTTCAATTCAAT
 
. : . : . : . : . : . :
JMFF017O11- TTTCACT-TCAACTCAAAGCAAAGCTGCAGAAGAAGAGAGGTTTGATTCTTGGTCATCGT
JMFF043M18- TTTCACT-TCAACTCAAAGCAAAGCTGCAGAAGAAGAGAGGTTTGATTCTTGGTCATCGT
JMFF042K10- TNTAATTATGTGCTCAAAGCAAAGCTGCAGAAGAAGAGAGGTTTGATTCTTGGTCATCGT
JMSF036D11- TTTCACT-TCAACTCAAAGCAAAGCTGCAGAAGAAGAGAGGTTTGATTCTTGGTCATCGT
JMSF035A12- TTTCACT-TCAACTCAAAGCAAAGCTGCAGAAGAAGAGAGGTTTGATTCTTGGTCATCGT
JMSF048G22- TTTCACT-TCAACTCAAAGCAAAGCTGCAGAAGAAGAGAGGTTTGATTCTTGGTCATCGT
                      ____________________________________________________________
consensus TTTCACT-TCAACTCAAAGCAAAGCTGCAGAAGAAGAGAGGTTTGATTCTTGGTCATCGT
 
. : . : . : . : . : . :
JMFF017O11- CTCTACCAATCTTCACCTTCCCTGCTGTTCCTCTGTCCTTTTATTCCCCTCTCTGTTCCC
JMFF043M18- CTCTACCAATCTTCACCTTCCCTGCTGTTCCTCTGTCCTTTTATTCCCCTCTCTGTTCCC
JMFF042K10- CTCTACCAATCTTCACCTTCCCTGCTGTTCCTCTGTCCTTTTATTCCCCTCTCTGTTCCC
JMSF036D11- CTCTACCAATCTTCACCTTCCCTGCTGTTCCTCTGTCCTTTTATTCCCCTCTCTGCTCCC
JMSF035A12- CTCTACCAATCTTCACCTTCCCTGCTGTTCCTCTGTCCTTTTATTCCCCTCTCTGCTCCC
JMSF048G22- CTCTACCAATCTTCACCTTCCCTGCTGTTCCTCTGTCCTTTTATTCCCCTCTCTGCTCCC
JMSF044D05- CAATCTTCACCTTCCCTGCTGTTCCTCTGTCCTTTTATTCACCTCTCTGCTCCC
                      ____________________________________________________________
consensus CTCTACCAATCTTCACCTTCCCTGCTGTTCCTCTGTCCTTTTATTCCCCTCTCTGCTCCC
 
. : . : . : . : . : . :
JMFF017O11- CCTTCTTCAAAATCCAGAGGCCGAGTTATGTTATTTTTCATATAGATTCTTGGTTGATCG
JMFF043M18- CCTTCTTCAAAATCCAGAGGCCGAGTTATGTTATTTTTCATATAGATTCTTGGTTGATCG
JMFF042K10- CCTTCTTCAAAATCCAGAGGCCGAGTTATGTTATTTTTCATATAGATTCTTGGTTGATCG
JMSF036D11- CCTTCTTCAAAATCCAGAGGCCGAGTTATGTTATTTTTCATATAGATTCTTGGTTGATCG
JMSF035A12- CCTTCTTCAAAATCCAGAGGCCGAGTTATGTTATTTTTCATATAGATTCTTGGTTGATCG
JMSF048G22- CCTTCTTCAAAATCCAGAGGCCGAGTTATGTTATTTTTCATATAGATTCTTGGTTGATCG
JMSF044D05- CCTTCTTCAAAATCCAGAGGCCGAGTTATGTTATTTTTCATATAGATTCTTGGTTGATCG
                      ____________________________________________________________
consensus CCTTCTTCAAAATCCAGAGGCCGAGTTATGTTATTTTTCATATAGATTCTTGGTTGATCG
 
. : . : . : . : . : . :
JMFF017O11- AGCGAATATGAATATGAATAATCGTGGGTTGTTAACGACAGACTCGTTTTGTAACTCCGG
JMFF043M18- AGCGAATATGAATATGAATAATCGTGGGTTGTTAACGACAGACTCGTTTTGTAACTCCGG
JMFF042K10- AGCGAATATGAATATGAATAATCGTGGGTTGTTAACGACAGACTCGTTTTGTAACTCCGG
JMSF036D11- AGCGAATATGAATATGAATAATCGTGGGTTGTTAACGACAGACTCGTTTTGTAACTCCGG
JMSF035A12- AGCGAATATGAATATGAATAATCGTGGGTTGTTAACGACAGACTCGTTTTGTAACTCCGG
JMSF048G22- AGCGAATATGAATATGAATAATCGTGGGTTGTTAACGACAGACTCGTTTTGTAACTCCGG
JMSF044D05- AGCGAATATGAATATGAATAATCGTGGGTTGTTAACGACAGACTCGTTTTGTAACTCCGG
                      ____________________________________________________________
consensus AGCGAATATGAATATGAATAATCGTGGGTTGTTAACGACAGACTCGTTTTGTAACTCCGG
 
. : . : . : . : . : . :
JMFF017O11- GGCTGCAGCCACTTCGGGCGAAGATACGATGATGTCTGTGGTTGCAAGAACCCAGAGCCA
JMFF043M18- GGCTGCAGCCACTTCGGGCGAAGATACGATGATGTCTGTGGTTGCAAGAACCCAGAGCCA
JMFF042K10- GGCTGCAGCCACTTCGGGCGAAGATACGATGATGTCTGTGGTTGCAAGAACCCAGAGCCA
JMSF036D11- GGCTGCAGCCACTTCGGGCGAAGATACGATGATGTCTGTGGTTGCAAGAACCCAGAGCCA
JMSF035A12- GGCTGCAGCCACTTCGGGCGAAGATACGATGATGTCTGTGGTTGCAAGAACCCAGAGCCA
JMSF048G22- GGCTGCAGCCACTTCGGGCGAAGATACGATGATGTCTGTGGTTGCAAGAACCCAGAGCCA
JMSF044D05- GGCTGCAGCCACTTCGGGCGAAGATACGATGATGTCTGTGGTTGCAAGAACCCAGAGCCA
                      ____________________________________________________________
consensus GGCTGCAGCCACTTCGGGCGAAGATACGATGATGTCTGTGGTTGCAAGAACCCAGAGCCA
 
. : . : . : . : . : . :
JMFF017O11- GTCAAGAACACAGCCTTCTCCTTTCATGGTGAGAGTGGCAATGAGAATATCGAGAGCGAG
JMFF043M18- GTCAAGAACACAGCCTTCTCCTTTCATGGTGAGAGTGGCAATGAGAATATCGAGAGCGAG
JMFF042K10- GTCAAGAACACAGCCTTCTCCTTTCATGGTGAGAGTGGCAATGAGAATATCGAGAGCGAG
JMSF036D11- GTCAAGAACACAGCCTTCTCCTTTCATGGTGAGAGTGGCAATGAGAATATCGAGAGCGAG
JMSF035A12- GTCAAGAACACAGCCTTCTCCTTTCATGGTGAGAGTGGCAATGAGAATATCGAGAGCGAG
JMSF048G22- GTCAAGAACACAGCCTTCTCCTTTCATGGTGAGAGTGGCAATGAGAATATCGAGAGCGAG
JMSF044D05- GTCAAGAACACAGCCTTCTCCTTTCATGGTGAGAGTGGCAATGAGAATATCGAGAGCGAG
                      ____________________________________________________________
consensus GTCAAGAACACAGCCTTCTCCTTTCATGGTGAGAGTGGCAATGAGAATATCGAGAGCGAG
 
. : . : . : . : . : . :
JMFF017O11- GTGGTTCATCTTCCTGAG
JMFF043M18- GTGGTTCATCTTCCTGAGAAGAGTGTTTCACTACCAGAATGGATCAACAACGTCTGATCT
JMFF042K10- GTGGTTCATCTTCCTGAGAAGAGTGTTTCACTACCAGAATGGATCAACAACGTCTGATCT
JMSF036D11- GTGGTTCATCTTCCTGAGAAGAGTGTTTCACTACCAGAATGGATCAACAACGTCTGATCT
JMSF035A12- GTGGTTCATCTTCCTGAGAAGAGTGTTTCACTACCAGAATGGATCAACAACGTCTGATCT
JMSF048G22- GTGGTTCATCTTCCTGAGAAGAGTGTTTCACTACCAGAATGGATCAACAACGTCTGATCT
JMSF044D05- GTGGTTCATCTTCCTGAGAAGAGTGTTTCACTACCAGAATGGATCAACAACGTCTGATCT
                      ____________________________________________________________
consensus GTGGTTCATCTTCCTGAGAAGAGTGTTTCACTACCAGAATGGATCAACAACGTCTGATCT
 
. : . : . : . : . : . :
JMFF043M18- CGGGTCGAATCCGTTCAATTCCCTGACTTGGATGATGATGGAGTGTGTAACTTTG
JMFF042K10- CGGGTCGAATCCGTTCAATTCCCTGACTTGGATGATGATGGAGTGTGTAACTTTGAGTGT
JMSF036D11- CGGGTCGAATCCGTTCAATTCCCTGACTTGGATGATGATGGAGTGTGTAACTTTGAGTGT
JMSF035A12- CGGGTCGAATCCGTTCAATTCCCTGACTTGGATGATGATGGAGTGTGTAACTTTGAGTGT
JMSF048G22- CGGGTCGAATCCGTTCAATTCCCTGACTTGGATGATGATGGAGTGTGTAACTTTGAGTGT
JMSF044D05- CGGGTCGAATCCGTTCAATTCCCTGACTTGGATGATGATGGAGTGTGTAACTTTGAGTGT
                      ____________________________________________________________
consensus CGGGTCGAATCCGTTCAATTCCCTGACTTGGATGATGATGGAGTGTGTAACTTTGAGTGT
 
. : . : . : . : . : . :
JMFF042K10- CCAAATCATGTTTACAGCAT
JMSF036D11- CCAAATCATGTTTACAGCATATACCCTGGCTGTCTCAAAGGAGGAAAGGCCTGTTTGGCC
JMSF035A12- CCAAATCATGTTTACAGCATATACCCTGGCTGTCTCAAAGGAGGAAAGGCCTGTTTGGCC
JMSF048G22- CCAAATCATGTTTACAGCATATACCCTGGCTGTCTCAAAGGAGGAAAGGCCTGTTTGGCC
JMSF044D05- CCAAATCATGTTTACAGCATATACCCTGGCTGTCTCAAAGGAGGAAAGGCCTGTTTGGCC
                      ____________________________________________________________
consensus CCAAATCATGTTTACAGCATATACCCTGGCTGTCTCAAAGGAGGAAAGGCCTGTTTGGCC
 
. : . : . : . : . : . :
JMSF036D11- GATGCGAATTTGGGTTTCGGGCTATGCTTTTGGCTGTCTGCTTAGCCTTTTGCTACTCTA
JMSF035A12- GATGCGAATTTGGGTTTCGGGCTATGCTTTTGGCTGTCTGCTTAGCCNTTTGCTACTCTA
JMSF048G22- GATGCGAATTTGGGTTTCGGGCTATGCTTTTGGCTGTCTGCTTAGCCTTTTGCTACTCTA
JMSF044D05- GATGCGAATTTGGGTTTCGGGCTATGCTTTTGGCTGTCTGCTTAGCCTTTTGCTACTCTA
                      ____________________________________________________________
consensus GATGCGAATTTGGGTTTCGGGCTATGCTTTTGGCTGTCTGCTTAGCCTTTTGCTACTCTA
 
. : . : . : . : . : . :
JMSF036D11- CTGCA
JMSF035A12- CTGCA
JMSF048G22- CTGCA
JMSF044D05- CTGCAGATATTGGGTGTTCTATCTGAGGCAGAGAGATGAGTCTTCTGCAGTATCTGATAT
rJMSF048G22+ GAGGCAGAGAGATGAGTCTTCTGCAGTATCTGATAT
rJMSF035A12+ GAGGCAGAGAGATGAGTTTTCTGCAGTATNTGATAT
rJMFF017O11+ GAGGCAGAGAGATGAGTCTTCTGCAGTATCTGATAT
                      ____________________________________________________________
consensus CTGCAGATATTGGGTGTTCTATCTGAGGCAGAGAGATGAGTCTTCTGCAGTATCTGATAT
 
. : . : . : . : . : . :
JMSF044D05- AGAGCAGCAAAGAAGCCTTGAGGGATCAAGTGTGCAAATGGTGGAGAAATGCAGGACCTG
rJMSF048G22+ AGAGCAGCAAAGAAGCCTTGAGGGATCAAGTGTGCAAATGGTGGAGAAATGCAGGACCTG
rJMSF044D05+ GTGCAAATGGTGGAGAAATGCAGGACCTG
rJMSF035A12+ AGAGCAGCAAAGAAGCCNTGAGGGATCAAGTGTGCAAATGGTGGAGAAATGCAGGACCTG
rJMFF017O11+ AGAGCAGCAAAGAAGCCTTGAGGGATCAAGTGTGCAAATGGTGGAGAAATGCAGGACCTG
                      ____________________________________________________________
consensus AGAGCAGCAAAGAAGCCTTGAGGGATCAAGTGTGCAAATGGTGGAGAAATGCAGGACCTG
 
. : . : . : . : . : . :
JMSF044D05- CGTTGAGCTATTCTTCGCGATATGGTTCGTGATGGGGAACGTTTGGGTGTTTGACACGCG
rJMSF048G22+ CGTTGAGCTATTCTTCGCGATATGGTTCGTGATGGGGAACGTTTGGGTGTTTGACACGCG
rJMSF044D05+ CGTTGAGCTATTCTTCGCGATATGGTTCGTGATGGGGAACGTTTGGGTGTTTGACACGCG
rJMSF036D11+ GCGATATGGTTCGTGATGGGGAACGTTTGGGTGTTTGACACGCG
rJMSF035A12+ CGTTGAGCTATTCTTCGCGATATGGTTCGTGATGGGGAACGTTTGGGTGTTTGACACGCG
rJMFF017O11+ CGTTGAGCTATTCTTCGCGATATGGTTCGTGATGGGGAACGTTTGGGTGTTTGACACGCG
                      ____________________________________________________________
consensus CGTTGAGCTATTCTTCGCGATATGGTTCGTGATGGGGAACGTTTGGGTGTTTGACACGCG
 
. : . : . : . : . : . :
JMSF044D05- ATTTGGATCGTTTCGTCGTGCCCCAAAGCTCCATGTTCTATGCATCTCTCTGCTGGCCTG
rJMSF048G22+ ATTTGGATCGTTTCGTCGTGCCCCAAAGCTCCATGTTCTATGCATCTCTCTGCTGGCCTG
rJMSF044D05+ ATTTGGATCGTTTCGTCGTGCCCCAAAGCTCCATGTTCTATGCATCTCTCTGCTGGCCTG
rJMSF036D11+ ATTTGGATCGTTTCGTCGTGCCCCAAAGCTCCATGTTCTATGCATCTCTCTGCTGGCCTG
rJMSF035A12+ ATTTGGATCGTTTCGTCGTGCCCCAAAGCTCCATGTTCTATGCATCTCTCTGCTGGCCTG
rJMFF017O11+ ATTTGGATCGTTTCGTCGTGCCCCAAAGCTCCATGTTCTATGCATCTCTCTGCTGGCCTG
rJMFF042K10+ CTG
                      ____________________________________________________________
consensus ATTTGGATCGTTTCGTCGTGCCCCAAAGCTCCATGTTCTATGCATCTCTCTGCTGGCCTG
 
. : . : . : . : . : . :
JMSF044D05- GAATGCTGTCACCTACTCATTCCCATTCATTCTGTTGGTGGTGCTGTGCTGCTGTGTGCC
rJMSF048G22+ GAATGCTGTCACCTACTCATTCCCATTCATTCTGTTTGTGGTGCTGTGCTGCTGTGTGCC
rJMSF044D05+ GAATGCTGTCACCTACTCATTCCCATTCATTCTGTTTGTGGTGCTGTGCTGCTGTGTGCC
rJMSF036D11+ GAATGCTGTCACCTACTCATTCCCATTCATTCTGTTTGTGGTGCTGTGCTGCTGTGTGCC
rJMSF035A12+ GAATGCTGTCACCTACTCATTCCCATTCATTCTGTTTGTGGTGCTGTGCTGCTGTGTGCC
rJMFF017O11+ GAATGCTGTCACCTACTCATTCCCATTCATTCTGTTTGTGGTGCTGTGCTGCTGTGTGCC
rJMFF043M18+ CCATTCATTCTGTTTGTGGTGCTGTGCTGCTGTGTGCC
rJMFF042K10+ GAATGCTGTCACCTACTCATTCCCATTCATTCTGTTTGTGGTGCTGTGCTGCTGTGTGCC
                      ____________________________________________________________
consensus GAATGCTGTCACCTACTCATTCCCATTCATTCTGTTTGTGGTGCTGTGCTGCTGTGTGCC
 
. : . : . : . : . : . :
JMSF044D05- CATGGTTAGCA
rJMSF048G22+ CATGGTTAGCAGCTTCCTAGGATACAACATGAACATGGGATCTGTCGAGCGGGGGGCATC
rJMSF044D05+ CATGGTTAGCAGCTTCCTAGGATACAACATGAACATGGGATCTGTCGAGCGGGGGGCATC
rJMSF036D11+ CATGGTTAGCAGCTTCCTAGGATACAACATGAACATGGGATCTGTCGAGCGGGGGGCATC
rJMSF035A12+ CATGGTTAGCAGCTTCCTAGGATACAACATGAACATGGGATCTGTCGAGCGGGGGGCATC
rJMFF017O11+ CATGGTTAGCAGCTTCCTAGGATACAACATGAACATGGGATCTGTCGAGCGGGGGGCATC
rJMFF043M18+ CATGGTTAGCAGCTTCCTAGGATACAACATGAACATGGGATCTGTCGAGCGGGGGGCATC
rJMFF042K10+ CATGGTTAGCAGCTTCCTAGGATACAACATGAACATGGGATCTGTCGAGCGGGGGGCATC
                      ____________________________________________________________
consensus CATGGTTAGCAGCTTCCTAGGATACAACATGAACATGGGATCTGTCGAGCGGGGGGCATC
 
. : . : . : . : . : . :
rJMSF048G22+ CAATGAACAGCTCTCTAGTTTGCCAACCTGGAAGTACAAGCAAGTCTGCAACAACCCAGA
rJMSF044D05+ CAATGAACAGCTCTCTAGTTTGCCAACCTGGAAGTACAAGCAAGTCTGCAACAACCCAGA
rJMSF036D11+ CAATGAACAGCTCTCTAGTTTGCCAACCTGGAAGTACAAGCAAGTCTGCAACAACCCAGA
rJMSF035A12+ CAATGAACAGCTCTCTAGTTTGCCAACCTGGAAGTACAAGCAAGTCTGCAACAACCCAGA
rJMFF017O11+ CAATGAACAGCTCTCTAGTTTGCCAACCTGGAAGTACAAGCAAGTCTGCAACAACCCAGA
rJMFF043M18+ CAATGAACAGCTCTCTAGTTTGCCAACCTGGAAGTACAAGCAAGTCTGCAACAACCCAGA
rJMFF042K10+ CAATGAACAGCTCTCTAGTTTGCCAACCTGGAAGTACAAGCAAGTCTGCAACAACCCAGA
                      ____________________________________________________________
consensus CAATGAACAGCTCTCTAGTTTGCCAACCTGGAAGTACAAGCAAGTCTGCAACAACCCAGA
 
. : . : . : . : . : . :
rJMSF048G22+ TTTGGAGAATGAAAATCCAGAATGCTGCATTTGCTTAGCACAGTATCGTGACAAGGAAGA
rJMSF044D05+ TTTGGAGAATGAAAATCCAGAATGCTGCATTTGCTTAGCACAGTATCGTGACAAGGAAGA
rJMSF036D11+ TTTGGAGAATGAAAATCCAGAATGCTGCATTTGCTTAGCACAGTATCGTGACAAGGAAGA
rJMSF035A12+ TTTGGAGAATGAAAATCCAGAATGCTGCATTTGCTTAGCACAGTATCGTGACAAGGAAGA
rJMFF017O11+ TTTGGAGAATGAAAATCCAGAATGCTGCATTTGCTTAGCACAGTATCGTGACAAGGAAGA
rJMFF043M18+ TTTGGAGAATGAAAATCCAGAATGCTGCATTTGCTTAGCACAGTATCGTGACAAGGAAGA
rJMFF042K10+ TTTGGAGAATGAAAATCCAGAATGCTGCATTTGCTTAGCACAGTATCGTGACAAGGAAGA
                      ____________________________________________________________
consensus TTTGGAGAATGAAAATCCAGAATGCTGCATTTGCTTAGCACAGTATCGTGACAAGGAAGA
 
. : . : . : . : . : . :
rJMSF048G22+ AATGAGACAACTGCCATGTTCCCATGTATTTCATCTCAACTGTGTTGATCAATGGCTCAG
rJMSF044D05+ AATGAGACAACTGCCATGTTCCCATGTATTTCATCTCAACTGTGTTGATCAATGGCTCAG
rJMSF036D11+ AATGAGACAACTGCCATGTTCCCATGTATTTCATCTCAACTGTGTTGATCAATGGCTCAG
rJMSF035A12+ AATGAGACAACTGCCATGTTCCCATGTATTTCATCTCAACTGTGTTGATCAATGGCTCAG
rJMFF017O11+ AATGAGACAACTGCCATGTTCCCATGTATTTCATCTCAACTGTGTTGATCAATGGCTCAG
rJMFF043M18+ AATGAGACAACTGCCATGTTCCCATGTATTTCATCTCAACTGTGTTGATCAATGGCTCAG
rJMFF042K10+ AATGAGACAACTGCCATGTTCCCATGTATTTCATCTCAACTGTGTTGATCAATGGCTCAG
                      ____________________________________________________________
consensus AATGAGACAACTGCCATGTTCCCATGTATTTCATCTCAACTGTGTTGATCAATGGCTCAG
 
. : . : . : . : . : . :
rJMSF048G22+ AATCATATCTTGCTGCCCTCTCTGTAAAAAGGATTTAGCTAGATAGATGAAGTCACGATG
rJMSF044D05+ AATCATATCTTGCTGCCCTCTCTGTAAAAAGGATTTAGCTAGATAGATGAAGTCACGATG
rJMSF036D11+ AATCATATCTTGCTGCCCTCTCTGTAAAAAGGATTTAGCTAGATAGATGAAGTCACGATG
rJMSF035A12+ AATCATATCTTGCTGCCCTCTCTGTAAAAAGGATTTAGCTAGATAGATGAAGTCACGATG
rJMFF017O11+ AATCATATCTTGCTGCCCTCTCTGTAAAAAGGATTTAGCTAGATAGATGAAGTCACGATG
rJMFF043M18+ AATCATATCTTGCTGCCCTCTCTGTAAAAAGGATTTAGCTAGATAGATGAAGTCACGATG
rJMFF042K10+ AATCATATCTTGCTGCCCTCTCTGTAAAAAGGATTTAGCTAGATAGATGAAGTCACGATG
                      ____________________________________________________________
consensus AATCATATCTTGCTGCCCTCTCTGTAAAAAGGATTTAGCTAGATAGATGAAGTCACGATG
 
. : . : . : . : . : . :
rJMSF048G22+ ATGATGCTAGGTTTCCCTGCA-TTTTTTTTCTTAATTTTATTTTCTGATACATACATAAT
rJMSF044D05+ ATGATGCTAGGTTTCCCTGCATTTTTTTTTCTTAATTTTATTTTCTGATACATACATAAT
rJMSF036D11+ ATGATGCTAGGTTTCCCTGCA-TTTTTTTTCTTAATTTTATTTTCTGATACATACATAAT
rJMSF035A12+ ATGATGCTAGGTTTCCCTGCA-TTTTTTTTCTTAATTTTATTTTCTGATACATACATAAT
rJMFF017O11+ ATGATGCTAGGTTTCCCTGCA-TTTTTTTTCTTAATTTTATTTTCTGATACATACATAAT
rJMFF043M18+ ATGATGCTAGGTTTCCCTGCA-TTTTTTTTCTTAATTTTATTTTCTGATACATACATAAT
rJMFF042K10+ ATGATGCTAGGTTTCCCTGCA-TTTTTTTTCTTAATTTTATTTTCTGATACATACATAAT
                      ____________________________________________________________
consensus ATGATGCTAGGTTTCCCTGCA-TTTTTTTTCTTAATTTTATTTTCTGATACATACATAAT
 
. : . : . : . : . : . :
rJMSF048G22+ TAAACAAGCATAAAGGGAAGATATATAATTGTATGTAATGTAATAGAGTGAGGAAAATCA
rJMSF044D05+ TAAACAAGCATAAAGGGAAGATATATAATTGTATGTAATGTAATAGAGTGAGGAAAATCA
rJMSF036D11+ TAAACAAGCATAAAGGGAAGATATATAATTGTATGTAATGTAATAGAGTGAGGAAAATCA
rJMSF035A12+ TAAACAAGCATAAAGGGAAGATATATAATTGTATGTAATGTAATAGAGTGAGGAAAATCA
rJMFF017O11+ TAAACAAGCATAAAGGGAAGATATATAATTGTATGTAATGTAATAGAGTGAGGAAAATCA
rJMFF043M18+ TAAACAAGCATAAAGGGAAGATATATAATTGTATGTAATGTAATAGAGTGAGGAAAATCA
rJMFF042K10+ TAAACAAGCATAAAGGGAAGATATATAATTGTATGTAATGTAATAGAGTGAGGAAAATCA
                      ____________________________________________________________
consensus TAAACAAGCATAAAGGGAAGATATATAATTGTATGTAATGTAATAGAGTGAGGAAAATCA
 
. : . : . : . : . : . :
rJMSF048G22+ TGTTGAAAGTGGAAGATCTGAACTTGTTTCATTTGAGTGGGGAGACTGCCATCCATCTCT
rJMSF044D05+ TGTTGAAAGTGGAAGATCTGAACTTGTTTCATTTGAGTGGGGAGACTGCCATCCATCTCT
rJMSF036D11+ TGTTGAAAGTGGAAGATCTGAACTTGTTTCATTTGAGTGGGGAGACTGCCATCCATCTCT
rJMSF035A12+ TGTTGAAAGTGGAAGATCTGAACTTGTTTCATTTGAGTGGGGAGACTGCCATCCATCTCT
rJMFF017O11+ TGTTGAAAGTGGAAGATCTGAACTTGTTTCATTTGAGTGGGAAGACTGCCATCCATCTCT
rJMFF043M18+ TGTTGAAAGTGGAAGATCTGAACTTGTTTCATTTGAGTGGGAAGACTGCCATCCATCTCT
rJMFF042K10+ TGTTGAAAGTGGAAGATCTGAACTTGTTTCATTTGAGTGGGAAGACTGCCATCCATCTCT
                      ____________________________________________________________
consensus TGTTGAAAGTGGAAGATCTGAACTTGTTTCATTTGAGTGGGGAGACTGCCATCCATCTCT
 
. : . : . : . : . : . :
rJMSF048G22+ CCCAAGTCCCAAATACT
rJMSF044D05+ CCCAAGTCCC
rJMSF036D11+ CCCAAGTCCCAAATACT
rJMSF035A12+ CCCAAGTCCCAAATACT
rJMFF017O11+ CCCAAGTCCCAAATACTTGTAAATGTTAAAATAGTCTCAATGCAAAA
rJMFF043M18+ CCCAAGTCCCAAATACTTGTAAATGTTAAAATAGTCTCAATGCAAAATGTTCAAAGAATC
rJMFF042K10+ CCCAAGTCCCAAATACTTGTAAATGTTAAAATAGTCTCAATGCAAAATGTTCAAAGAATC
                      ____________________________________________________________
consensus CCCAAGTCCCAAATACTTGTAAATGTTAAAATAGTCTCAATGCAAAATGTTCAAAGAATC