Previous Contig 010238:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005P21Sequence749010238 (2)
JMFF042J11Sequence633001814 (2)gb:AP005398_18511232e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P066561010238 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF005P21+ AGTATCAGCAGTCGCAGAAGTCAAAGGCACAGCTTCAATCACTTCATCCACAG
                      ____________________________________________________________
consensus AGTATCAGCAGTCGCAGAAGTCAAAGGCACAGCTTCAATCACTTCATCCACAG
 
. : . : . : . : . : . :
rJMFF005P21+ CCAATTTCGGCAGTGACCAGTAAACGAGCATTGCCAAAGGATTTAAACACACGGCAAGTT
                      ____________________________________________________________
consensus CCAATTTCGGCAGTGACCAGTAAACGAGCATTGCCAAAGGATTTAAACACACGGCAAGTT
 
. : . : . : . : . : . :
rJMFF005P21+ GAAACTACGGCACAAGGTGGATCAACTAGTTTTGCACGTCCTGCTGGTCACATTCCCTTT
                      ____________________________________________________________
consensus GAAACTACGGCACAAGGTGGATCAACTAGTTTTGCACGTCCTGCTGGTCACATTCCCTTT
 
. : . : . : . : . : . :
rJMFF005P21+ AAGCCTAGGGCTGTTCAAAATCTCAATTCTGATAACCTGACTACAAAAAATATTGCGAGC
                      ____________________________________________________________
consensus AAGCCTAGGGCTGTTCAAAATCTCAATTCTGATAACCTGACTACAAAAAATATTGCGAGC
 
. : . : . : . : . : . :
rJMFF005P21+ AATGCACCTGCTCCATCTATTTCACTTGCTGATGCCTTTAAGAGTAGTCCCCCTAGACAA
rJMFF042J11+ AAGAGTAGTCCCCCTAGACAA
                      ____________________________________________________________
consensus AATGCACCTGCTCCATCTATTTCACTTGCTGATGCCTTTAAGAGTAGTCCCCCTAGACAA
 
. : . : . : . : . : . :
rJMFF005P21+ GAGGATTCAACTGAAGCTGGAAATATTGCTCGTGGGCAGAGCAGCAGAGCTGGTGCATCA
rJMFF042J11+ GAGGATTCAACTGAAGCTGGAAATATTGCTCGTGGGCAGAGCAGCAGAGCTGGTGCATCA
                      ____________________________________________________________
consensus GAGGATTCAACTGAAGCTGGAAATATTGCTCGTGGGCAGAGCAGCAGAGCTGGTGCATCA
 
. : . : . : . : . : . :
rJMFF005P21+ AGCAGCAGGCTACCATTCTTACATCGGATTTCATCAGCAAAGTGAATTGGTATTAAGATA
rJMFF042J11+ AGCAGCAGGCTACCATTTTTACATCGGATTTCATCAGCAAAGTGAATTGGTATTAAGATA
                      ____________________________________________________________
consensus AGCAGCAGGCTACCATTTTTACATCGGATTTCATCAGCAAAGTGAATTGGTATTAAGATA
 
. : . : . : . : . : . :
rJMFF005P21+ TGAGGGGATCTAAGGAGGGGATTATATGCATATATTGATCAATTCTCTGAAGTTGGATTC
rJMFF042J11+ TGAGGGGATCTAAGGAGGGGATTATATGCATATATTGATCAATTCTTTGAAGTTGGATTC
                      ____________________________________________________________
consensus TGAGGGGATCTAAGGAGGGGATTATATGCATATATTGATCAATTCTTTGAAGTTGGATTC
 
. : . : . : . : . : . :
rJMFF005P21+ ACTTGAACCCGAGTCTACAAGATTTCTTATGTATTTATCTTAAGGTGATTATGAAGTACA
rJMFF042J11+ ACTTGAACCCGAGTTTACAAGATTTTTTATGTATTTATCTTAAGGTGATTATGAAGTACA
                      ____________________________________________________________
consensus ACTTGAACCCGAGTTTACAAGATTTTTTATGTATTTATCTTAAGGTGATTATGAAGTACA
 
. : . : . : . : . : . :
rJMFF005P21+ AATGCTTTGAATGTCGCTAGAACATGGAGTACCAAAATGGTTGTCTTGGGATATATTAAT
rJMFF042J11+ AATGCTTTGAATGTCGCTAGAACATGGAGTACCAAAATGGTTGTCTTGGGATATATTAAT
                      ____________________________________________________________
consensus AATGCTTTGAATGTCGCTAGAACATGGAGTACCAAAATGGTTGTCTTGGGATATATTAAT
 
. : . : . : . : . : . :
rJMFF005P21+ GGAAAATTTTGACTAAGCACCATCTACCATTAGTGTTCCATGGATGATGTGTAAATTGTT
rJMFF042J11+ GGAAAATTTTGACTAAGCACCATCTACCATTAGTGTTCCATGGATGATGTGTAAATTGTT
                      ____________________________________________________________
consensus GGAAAATTTTGACTAAGCACCATCTACCATTAGTGTTCCATGGATGATGTGTAAATTGTT
 
. : . : . : . : . : . :
rJMFF005P21+ TCTTTAATTCTCATGTTAATAGACATCAAGGCCCGTTTTCACGATAATTTTCATTATCTA
rJMFF042J11+ TCTTTAATTCTCATGTTAATAGACATCAAGGCCCGTTTTCACGATAATTTTCATTATCTA
                      ____________________________________________________________
consensus TCTTTAATTCTCATGTTAATAGACATCAAGGCCCGTTTTCACGATAATTTTCATTATCTA
 
. : . : . : . : . : . :
rJMFF005P21+ GACAATGTAAATCAGTTTCTGATGGAATTTTTT
rJMFF042J11+ GACAATGTAAATCAGTTTTTGATGGAATTTTTTTCCATGTTTTGTATTGATTTAATTCTT
                      ____________________________________________________________
consensus GACAATGTAAATCAGTTTTTGATGGAATTTTTTTCCATGTTTTGTATTGATTTAATTCTT
 
. : . : . : . : . : . :
rJMFF042J11+ TTGAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAAGTCGCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TTGAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAAGTCGCCAGGGTGATCCGCCATAAGG