Previous Contig 010235:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001F23Sequence445000270 (14)gb:AY037937_15601735e-41Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.771010235 (13)gb:AY037937_1560173e-109Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.
JMFF005J04Sequence500000270 (14)gb:AY037937_15601731e-40Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.711010235 (13)gb:AY037937_15601731e-93Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.
JMFF017N06Sequence543000270 (14)gb:AY037937_15601731e-64Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.778010235 (13)gb:AY037937_1560173e-111Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.
JMFF025F11Sequence566000270 (14)gb:AY037937_15601736e-68Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.719010235 (13)gb:AY037937_15601731e-95Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.
JMFF035A11Sequence424000270 (14)gb:AY037937_15601735e-41Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.363010235 (13)gb:AY037937_15601731e-32Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.
JMFF036M20Sequence576000270 (14)gb:AY037937_15601731e-81Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.545010235 (13)gb:AY037937_15601732e-84Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.
JMFF037J14Sequence252000270 (14)gb:AY037937_15601732e-16Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.771010235 (13)gb:AY037937_1560173e-109Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.
JMFF042J06Sequence642000270 (14)gb:AY037937_15601739e-74Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.585010235 (13)gb:AY037937_15601733e-67Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.
JMFN039D22Sequence609010235 (13)gb:AF017082_1761529e-114Ipomoea batatas beta-fructofuranosidase (Ibbfruct1) mRNA, complete cds.
JMSF012K10Sequence554000270 (14)gb:AY037937_15601733e-63Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.759010235 (13)gb:AF017082_17615295e-86Ipomoea batatas beta-fructofuranosidase (Ibbfruct1) mRNA, complete cds.
JMSF015M12Sequence514000270 (14)gb:AY037937_15601732e-53Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.745010235 (13)gb:AY037937_1560173e-110Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.
JMSF025O06Sequence679000270 (14)gb:AY037937_15601733e-91Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.774010235 (13)gb:AY037937_1560173e-116Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.
JMSF047G11Sequence692000270 (14)gb:AY037937_15601731e-93Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.787010235 (13)gb:AY037937_1560173e-127Ipomoea batatas soluble acid invertase FRUCT2 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN039D22- AATATCCGAATAATCCGGTGTTATTCCCGCCGCCA
                      ____________________________________________________________
consensus AATATCCGAATAATCCGGTGTTATTCCCGCCGCCA
 
. : . : . : . : . : . :
JMFN039D22- GGGATAGGTGTCAGGGACTTTAGGGACCCTACCACTGCATGGACATCTGGCAGTCAAAAC
                      ____________________________________________________________
consensus GGGATAGGTGTCAGGGACTTTAGGGACCCTACCACTGCATGGACATCTGGCAGTCAAAAC
 
. : . : . : . : . : . :
JMFN039D22- GGTCAATGGTTGGTTACAATAGGGTCCAAGGTCGGTAAAACCGGTATTTCACTTGTTTAT
                      ____________________________________________________________
consensus GGTCAATGGTTGGTTACAATAGGGTCCAAGGTCGGTAAAACCGGTATTTCACTTGTTTAT
 
. : . : . : . : . : . :
JMFN039D22- GAAACCACCAATTTCACCAGCTTTAAGCTCTTGGATGGAGTGTTGCATGCGGTTCCGGGT
                      ____________________________________________________________
consensus GAAACCACCAATTTCACCAGCTTTAAGCTCTTGGATGGAGTGTTGCATGCGGTTCCGGGT
 
. : . : . : . : . : . :
JMFN039D22- ACGGGTATGTGGGAATGCGTGGACTTGTACCCGGTTTCGACCACCGGAGAATACGGGCTT
                      ____________________________________________________________
consensus ACGGGTATGTGGGAATGCGTGGACTTGTACCCGGTTTCGACCACCGGAGAATACGGGCTT
 
. : . : . : . : . : . :
JMFN039D22- GACACGTCAGCTAACGGGTTAGGTATCAAGCACGTATTAAAAGCTAGTCTGGATGACGAT
                      ____________________________________________________________
consensus GACACGTCAGCTAACGGGTTAGGTATCAAGCACGTATTAAAAGCTAGTCTGGATGACGAT
 
. : . : . : . : . : . :
JMFN039D22- AAACACGATTACTATGCACTTGGAACATATGACCCGGTGAAAAACAAGTGGACACCCGAT
                      ____________________________________________________________
consensus AAACACGATTACTATGCACTTGGAACATATGACCCGGTGAAAAACAAGTGGACACCCGAT
 
. : . : . : . : . : . :
JMFN039D22- AACCCGGATTTGGATGTGGGTATCGGGTTGAGACTTGATTATGGGAAGTACTATGCATCC
                      ____________________________________________________________
consensus AACCCGGATTTGGATGTGGGTATCGGGTTGAGACTTGATTATGGGAAGTACTATGCATCC
 
. : . : . : . : . : . :
JMFN039D22- AAGACGTTTTATGATCAGAACAAGCAGAGAAGAATCTTGTGGGGATGGATTGGTGAAACT
                      ____________________________________________________________
consensus AAGACGTTTTATGATCAGAACAAGCAGAGAAGAATCTTGTGGGGATGGATTGGTGAAACT
 
. : . : . : . : . : . :
JMFN039D22- GATTTAGAATCTGTTGATCTCATGAAAGGCTGGGCATCTCTTCAGGCGATTCCTAGGACC
rJMSF047G11+ AGGCTGGGCATCTCTTCAGGCGATTCCTAGGACC
rJMFF017N06+ GGACC
                      ____________________________________________________________
consensus GATTTAGAATCTGTTGATCTCATGAAAGGCTGGGCATCTCTTCAGGCGATTCCTAGGACC
 
. : . : . : . : . : . :
JMFN039D22- ATAGTTTTCGACAAGAAGACTGGGACAAACGTGC
rJMSF047G11+ ATAGTTTTCGACAAGAAGACTGGGACAAACGTGCTT-CAATGGCCGGTTGAAGAAGTGGA
rJMFF017N06+ ATAGTTTTCGACAAGAAGACTGGGACAAACGTGCTTCCAATGGCCGGTTGAAGAAGTGGA
rJMSF012K10+ TGGGACAAACGTGCTT-CAATGGCCGGTTGAAGAAGTGGA
rJMSF025O06+ TGGGACAAACGTGCTT-CAATGGCCGGTTGAAGAAGTGGA
rJMFF037J14+ GAAGAAGTGGA
rJMSF015M12+ AAGAAGTGGA
rJMFF001F23+ GAAGAAGTGGA
                      ____________________________________________________________
consensus ATAGTTTTCGACAAGAAGACTGGGACAAACGTGCTT-CAATGGCCGGTTGAAGAAGTGGA
 
. : . : . : . : . : . :
rJMSF047G11+ AAGCTTGAGATCAGGAGATCCTATAACTGCTAAGGCGAATCTTGAACCGGGATCTGTGGT
rJMFF017N06+ AAGCTTGAGATCAGGAGATCCTATAACTGCTAAGGCGAATCTTGAACCGGGATCTGTGGT
rJMSF012K10+ AAGCTTGAGATCAGGAGATCCTATAACTGCTAAGGCGAATCTTGAACCGGGATCTGTGGT
rJMSF025O06+ AAGCTTGAGATCAGGAGATCCTATAACTGCTAAGGCGAATCTTGAACCGGGATCTGTGGT
rJMFF037J14+ AAGCTTGAGATCAGGAGATCNTATAACTGCTAAGGCGAATCTTGAACCGGGATCTGTGGT
rJMSF015M12+ AAGCTTGAGATCAGGAGATCCTATAACTGCTAAGGCGAATCTTGAACCGGGATCTGTGGT
rJMFF025F11+ TGAACCGGGATCTGTGGT
rJMFF005J04+ GATCTGTGGT
rJMFF001F23+ AAGCTTGAGATCAGGAGATCNTATAACTGCTAAGGCGAATCTTGAACCGGGATCTGTGGT
                      ____________________________________________________________
consensus AAGCTTGAGATCAGGAGATCCTATAACTGCTAAGGCGAATCTTGAACCGGGATCTGTGGT
 
. : . : . : . : . : . :
rJMSF047G11+ GCCAATCCATGTTTCAGAGGGGACACAGTTAGACATAACTGCTTCATTTGAAGTGGATGA
rJMFF017N06+ GCCAATCCATGTTTCAGAGGGGACACAGTTAGACATAACTGCTTCATTTGAAGTGGATGA
rJMSF012K10+ GCCAATCCATGTTTCAGAGGGGACACAGTTAGACATAACTGCTTCATTTGAAGTGGATGA
rJMSF025O06+ GCCAATCCATGTTTCAGAGGGGACACAGTTAGACATAACTGCTTCATTTGAAGTGGATGA
rJMFF037J14+ GCCAATCCATGTTTCAGAGGGGACACAGTTAGACATAACTGCTTCATTTGAAGTGGATGA
rJMSF015M12+ GCCAATCCATGTTTCAGAGGGGACACAGTTAGACATAACTGCTTCATTTGAAGTGGATGA
rJMFF025F11+ GCCAATCCATGTTTCAGAGGGGACACAGTTAGACATAACTGCTTCATTTGAAGTGGATGA
rJMFF005J04+ GCCAATCCATGTTTCAGAGGGGACACAGTTAGACATAACTGCTTCATTTGAAGTGGATGA
rJMFF001F23+ GCCAATCCATGTTTCAGAGGGGACACAGTTAGACATAACTGCTTCATTTGAAGTGGATGA
                      ____________________________________________________________
consensus GCCAATCCATGTTTCAGAGGGGACACAGTTAGACATAACTGCTTCATTTGAAGTGGATGA
 
. : . : . : . : . : . :
rJMSF047G11+ AACCCTTCTTGAAACAACCTCGGAGT-CCCATGACGCTGGCTACGAGTGCAGTAATAGCG
rJMFF017N06+ AACCCTTCTTGAAACAACCTCGGAGTCCCCATGACGCTGGCTACGAGTGCAGTAATAGCG
rJMSF012K10+ AACCCTTCTTGAAACAACCTCGGAGT-CCCATGACGCTGGCTACGAGTGCAGTAATAGCG
rJMSF025O06+ AACCCTTCTTGAAACAACCTCGGAGT-CCCATGACGCTGGCTACGAGTGCAGTAATAGCG
rJMFF037J14+ AACCCTTCTTGAAACAACCTCGGAGT-CCCATGACGCTGGCTACGAGTGCAGTAATAGCG
rJMSF015M12+ AACCCTTCTTGAAACAACCTCGGAGT-CCCATGACGCTGGCTACGAGTGCAGTAATAGCG
rJMFF025F11+ AACCCTTCTTGAAACAACCTCGGAGTCCCCATGACGCTGGCTACGAGTGCAGTAATAGCG
rJMFF005J04+ AACCCTTCTTGAAACAACCTCGGAGTCCCCATGACGCTGGCTACGAGTGCAGTAATAGCG
rJMFF036M20+ CTTGAAACANCCTCGGAGT-CCCATGACGCTGGCTACGAGTGCAGTAATAGCG
rJMFF001F23+ AACCCTTCTTGAAACAACCTCGGAGT-CCCATGACGCTGGCTACGAGTGCAGTAATAGCG
                      ____________________________________________________________
consensus AACCCTTCTTGAAACAACCTCGGAGT-CCCATGACGCTGGCTACGAGTGCAGTAATAGCG
 
. : . : . : . : . : . :
rJMSF047G11+ GCGGCGCCGTTACACGCGGCAGTTTGGGACCGTTCGGGCTTCTGGTTGTCGCCGATGAAA
rJMFF017N06+ GCGGCGCCGTTACACGCGGCAGTTTGGGACCGTTCGGGCTTCTGGTTGTCGCCGATGAAA
rJMSF012K10+ GCGGCGCCGTTACACGCGGCAGTTTGGGACCGTTCGGGCTTCTGGTTGTCGCCGATGAAA
rJMSF025O06+ GCGGCGCCGTTACACGCGGCAGTTTGGGACCGTTCGGGCTTCTGGTTGTCGCCGATGAAA
rJMFF037J14+ GCGGCGCCGTTACACGCGGCAGTTTGGGACCGTTCGGGCTTCTGGTTGTCGCCGATGAAA
rJMSF015M12+ GCGGCGCCGTTACACGCGGCAGTTTGGGACCGTTCGGGCTTCTGGTTGTCGCCGATGAAA
rJMFF025F11+ GCGGCGCCGTTACACGCGGCAGTTTGGGACCGTTCGGGCTTCTGGTTGTCGCCGATGAAA
rJMFF005J04+ GCGGCGCCGTTACACGCGGCAGTTTGGGACCGTTCGGGCTTCTGGTTGTCGCCGATGAAA
rJMFF036M20+ GCGGCGCCGTTACACGCGGCAGTTTGGGACCGTTCGGGCTTCTGGTTGTCGCCGATGAAA
rJMFF001F23+ GCGGCGCCGTTACACGCGGCAGTTTGGGACCGTTCGGGCTTCTGGTTGTCGCCGATGAAA
rJMFF042J06+ CGCGGCAGTTTGGGACCGTTC-GGCTTCTGGTTGTCGCCGATGAAA
                      ____________________________________________________________
consensus GCGGCGCCGTTACACGCGGCAGTTTGGGACCGTTCGGGCTTCTGGTTGTCGCCGATGAAA
 
. : . : . : . : . : . :
rJMSF047G11+ AACTTTCTGAGTTGACGCCTGTCTACTTCTACATTGCTAAAGGCGCCGACGGGAAGACAA
rJMFF017N06+ AACTTTCTGAGTTGACGCCTGTCTACTTCTACATTGCTAAAGGCGCCGACGGGAAGACAA
rJMSF012K10+ AACTTTCTGAGTTGACGCCTGTCTACTTCTACATTGCTAAAGGCGCCGACGGGAAGACAA
rJMSF025O06+ AACTTTCTGAGTTGACGCCTGTCTACTTCTACATTGCTAAAGGCGCCGACGGGAAGACAA
rJMFF037J14+ AACTTTCTGAGTTGACGCCTGTCTACTTCTACATTGCTAAAGGCGCCGACGGGAAGACAA
rJMSF015M12+ AACTTTCTGAGTTGACGCCTGTCTACTTCTACATTGCTAAAGGCGCCGACGGGAAGACAA
rJMFF025F11+ AACTTTCTGAGTTGACGCCTGTCTACTTCTACATTGCTAAAGGCGCCGACGGGAAGACAA
rJMFF005J04+ AACTTTCTGAGTTGACGCCTGTCTACTTCTACATTGCTAAAGGCGCCGACGGGAAGACAA
rJMFF036M20+ AACTTTCTGAGTTGACGCCTGTCTACTTCTACATTGCTAAAGGCGCCGACGGGAAGACAA
rJMFF001F23+ AACTTTCTGAGTTGACGCCTGTCTACTTCTACATTGCTAAAGGCGCCGACGGGAAGACAA
rJMFF042J06+ AACTTTCTGAGTTGACGCCTGTCTACTTCTACATTGCTAAAGGCGCCGACGGGAAGACAA
                      ____________________________________________________________
consensus AACTTTCTGAGTTGACGCCTGTCTACTTCTACATTGCTAAAGGCGCCGACGGGAAGACAA
 
. : . : . : . : . : . :
rJMSF047G11+ ACACTCATTTCTGCGCCGACCAGACCAGATCATCCATGGCTTCTGGAGTTGAAAAGGAAG
rJMFF017N06+ ACACTCATTTCTGCGCCGACCAGACCAGATCATCCATGGCTTCTGGAGTTGAAAAGGAAG
rJMSF012K10+ ACACTCATTTCTGCGCCGACCAGACC--ATCATCCATGGCTTCTGGAGTTGAAAAGGAAG
rJMSF025O06+ ACACTCATTTCTGCGCCGACCAGACCAGATCATCCATGGCTTCTGGAGTTGAAAAGGAAG
rJMFF037J14+ ACACTCATTTCTGCGCCGACCAGACCAGATCATCCATGGCTTCTGGAGTTGAAAAGGAAG
rJMSF015M12+ ACACTCATTTCTGCGCCGACCAGACCAGATCATCCATGGCTTCTGGAGTTGAAAAGGAAG
rJMFF025F11+ ACACTCATTTCTGCGCCGACCAGACCAGATCATCCATGGCTTCTGGAGTTGAAAAGGAAG
rJMFF005J04+ ACACTCATTTCTGCGCCGACCAGACCAGATCATCCATGGCTTCTGGAGTTGAAAAGGAAG
rJMFF036M20+ ACACTCATTTCTGCGCCGACCAGACCAGATCATCCATGGCTTCTGGAGTTGAAAAGGAAG
rJMFF001F23+ ACACTCATTTCTGCGCCGACCAGACCAGATCATCCATGGCTTCTGGAGTTGAAAAGGAAG
rJMFF042J06+ ACACTCATTTCTGCGCCGACCAGACCAGATCATCCATGGCTTCTGGAGTTGAAAAGGAAG
                      ____________________________________________________________
consensus ACACTCATTTCTGCGCCGACCAGACCAGATCATCCATGGCTTCTGGAGTTGAAAAGGAAG
 
. : . : . : . : . : . :
rJMSF047G11+ TATATGGTAGCGCAGTGCCGGTTCTTGATGGTGAAAACTACTCTGCTAGAGTACTGATTG
rJMFF017N06+ TATATGGTAGCGCAGTGCCGGTTCTTGATGGTGAAAACTACTCTGCTAGAGTACTGATTG
rJMSF012K10+ TATATGGTAGCGCAGTGCCGGTTCTTGATGGTGAAAACTACTCTGCTAGAGTACTGATTG
rJMSF025O06+ TATATGGTAGCGCAGTGCCGGTTCTTGATGGTGAAAACTACTCTGCTAGAGTACTGATTG
rJMFF037J14+ TATATGGTAGCGCAGTGCCGGTTCTTGATGGTGAAAACTACTCTGCTAGAGTACTGATTG
rJMSF015M12+ TATATGGTAGCGCAGTGCCGGTTCTTGATGGTGAAAACTACTCTGCTAGAGTACTGATTG
rJMFF025F11+ TATATGGTAGCGCAGTGCCGGTTCTTGATGGTGAAAACTACTCTGCTAGAGTACTGATTG
rJMFF005J04+ TATATGGTAGCGCAGTGCCGGTTCTTGATGGTGAAAACTACTCTGCTAGAGTACTGATTG
rJMFF036M20+ TATATGGTAGCGCAGTGCCGGTTCTTGATGGTGAAAACTACTCTGCTAGAGTACTGATTG
rJMFF001F23+ TATATGGTAGCGCAGTGCCGGTTCTTGATGGTGAAAACTACTCTGCTAGAGTACTGATTG
rJMFF035A11+ CTCTGCTAGAGTACTGATTG
rJMFF042J06+ TATATGGTAGCGCAGTGCCGGTTCTTGATGGTGAAAACTACTCTGCTAGAGTACTGATTG
                      ____________________________________________________________
consensus TATATGGTAGCGCAGTGCCGGTTCTTGATGGTGAAAACTACTCTGCTAGAGTACTGATTG
 
. : . : . : . : . : . :
rJMSF047G11+ ATCATTCGATAGTAGAGAGCTTTGCTCAAGGAGGAAGAACGGTGATCACATCAAGAATTT
rJMFF017N06+ ATCATTCGATAGTAGAGAGCTTTGCTCAAGGAGGAAGAACGGTGATCACATCAAGAATTT
rJMSF012K10+ ATCATTCGATAGTAGAGAGCTTTGCTCAAGGAGGAAGAACGGTGATCACATCAAGAATTT
rJMSF025O06+ ATCATTCGATAGTAGAGAGCTTTGCTCAAGGAGGAAGAACGGTGATCACATCAAGAATTT
rJMFF037J14+ ATCATTCGATAGTAGAGAGCTTTGCTCAAGGAGGAAGAACGGTGATCACATCAAGAATTT
rJMSF015M12+ ATCATTCGATAGTAGAGAGCTTTGCTCAAGGAGGAAGAACGGTGATCACATCAAGAATTT
rJMFF025F11+ ATCATTCGATAGTAGAGAGCTTTGCTCAAGGAGGAAGAACGGTGATCACATCAAGAATTT
rJMFF005J04+ ATCATTCGATAGTAGAGAGCTTTGCTCAAGGAGGAAGAACGGTGATCACATCAAGAATTT
rJMFF036M20+ ATCATTCGATAGTAGAGAGCTTTGCTCAAGGAGGAAGAACGGTGATCACATCAAGAATTT
rJMFF001F23+ ATCATTCGATAGTAGAGAGCTTTGCTCAAGGAGGAAGAACGGTGATCACATCAAGAATTT
rJMFF035A11+ ATCATTCGATAGTNGAGAGCTTTGCTCAAGGAGGAAGAACGGTGATCACATCAAGAATTT
rJMFF042J06+ ATCATTCGATAGTAGAGAGCTTTGCTCAAGGAGGAAGAACGGTGATCACATCAAGAATTT
                      ____________________________________________________________
consensus ATCATTCGATAGTAGAGAGCTTTGCTCAAGGAGGAAGAACGGTGATCACATCAAGAATTT
 
. : . : . : . : . : . :
rJMSF047G11+ ATCCAACAAAAGCCATTTTTGGAGCTGCAAAAGTTTTCCTTTTCAACAATGCTACTAAAG
rJMFF017N06+ ATCCAACAAAAGCCATTTTTGGAGCTGCAAAAGTTTTCCTTTTCAACAATGCTACTAAAG
rJMSF012K10+ ATCCAACAAAAGCCATTTTTGGAGCTGCAAAAGTTTTCCTTTTCAACAATGCTACTAAAG
rJMSF025O06+ ATCCAACAAAAGCCATTTTTGGAGCTGCAAAAGTTTTCCTTTTCAACAATGCTACTAAAG
rJMFF037J14+ ATCCAACAAAAGCCATTTTTGGAGCTGCAAAAGTTTTCCTTTTCAACAATGCTACTAAAG
rJMSF015M12+ ATCCAACAAAAGCCATTTTTGGAGCTGCAAAAGTTTTCCTTTTCAACAATGCTACTAAAG
rJMFF025F11+ ATCCAACAAAAGCCATTTTTGGAGCTGCAAAAGTTTTCCTTTTCAACAATGCTACTAAAG
rJMFF005J04+ ATCCAACAAAAGCCATTTTTGGAGCTGCAAAAGTTTTCCTTTTCAACAATGCTACTAAAG
rJMFF036M20+ ATCCAACAAAAGCCATTTTTGGAGCTGCAAAAGTTTTCCTTTTCAACAATGCTACTAAAG
rJMFF001F23+ ATCCAACAAAAGCCATTTTTGGAGCTGCAAAAGTTTTCCTTTTCAACAATGCTACTAAAG
rJMFF035A11+ ATCCAACAAAAGCCATTTTTGGAGCTGCAAAAGTTTTCCTTTTCAACAATGCTACTAAAG
rJMFF042J06+ ATCCAACAAAAGCCATTTTTGGAGCTGCAAAAGTTTTCCTTTTCAACAATGCTACTAAAG
                      ____________________________________________________________
consensus ATCCAACAAAAGCCATTTTTGGAGCTGCAAAAGTTTTCCTTTTCAACAATGCTACTAAAG
 
. : . : . : . : . : . :
rJMSF047G11+ CTACTGTCACAGCATCGGTGAAGATGTGGCAAATGAATTCAGCGGATATTAAACGATTCC
rJMFF017N06+ CTACTGTCACAGCATCGGTGAAGATGTGGCAAATGAATTCAGCGGATATTAAACGATTCC
rJMSF012K10+ CTACTGTCACAGCATCGGTGAAGATGTGGCAAATGAATTCAGCGGATATTAAACGATTCC
rJMSF025O06+ CTACTGTCACAGCATCGGTGAAGATGTGGCAAATGAATTCAGCGGATATTAAACGATTCC
rJMFF037J14+ CTACTGTCACAGCATCGGTGAAGATGTGGCAAATGAATTCAGCGGATATTAAACGATTCC
rJMSF015M12+ CTACTGTCACAGCATCGGTGAAGATGTGGCAAATGAATTCAGCGGATATTAAACGATTCC
rJMFF025F11+ CTACTGTCACAGCATCGGTGAAGATGTGGCAAATGAATTCAGCGGATATTAAACGATTCC
rJMFF005J04+ CTACTGTCACAGCATCGGTGAAGATGTGGCAAATGAATTCAGCGGATATTAAACGATTCC
rJMFF036M20+ CTACTGTCACAGCATCGGTGAAGATGTGGCAAATGAATTCAGCGGATATTAAACGATTCC
rJMFF001F23+ CTACTGTCACAGCATCGGTGAAGATGTGGCAAATGAATTCAGCGGATATTAAACGATTCC
rJMFF035A11+ CTACTGTCACAGCATCGGTGAAGATGTGGCAAATGAATTCAGCGGATATTAAACGATTCC
rJMFF042J06+ CTACTGTCACAGCATCGGTGAAGATGTGGCAAATGAATTCAGCGGATATTAAACGATTCC
                      ____________________________________________________________
consensus CTACTGTCACAGCATCGGTGAAGATGTGGCAAATGAATTCAGCGGATATTAAACGATTCC
 
. : . : . : . : . : . :
rJMSF047G11+ CCTTGGATGAGTTGTAGTCCCATGAAAAAATTGTTGTATTTTAGTTTATATATGTCGTTT
rJMFF017N06+ CCTTGGATGAGTTGTAGTCCCATGAAAAAATTGTTGTATTTTAGTTTATATATGTCGTTT
rJMSF012K10+ CCTTGGATGAGTTGTAGTCCCATGAAAAAATTGTTGTATTTTAGTTTATATATGTCGTTT
rJMSF025O06+ CCTTGGATGAGTTGTAGTCCCATGAAAAAATTGTTGTATTTTAGTTTATATATGTCGTTT
rJMFF037J14+ CCTTGGATGAGTTGTAGTCCCATGAAAAAATTGTTGTATTTTAGTTTATATATGTCGTTT
rJMSF015M12+ CCTTGGATGAGTTGTAGTCCCATGAAAAAATTGTTGTATTTTAGTTTATATATGTCGTTT
rJMFF025F11+ CCTTGGATGAGTTGTAGTCCCATGAAAAAATTGTTGTATTTTAGTTTATATATGTCGTTT
rJMFF005J04+ CCTTGGATGAGTTGTAGTCCCATGAAAAAATTGTTGTATTTTAGTTTATATATGTCGTTT
rJMFF036M20+ CCTTGGATGAGTTGTAGTCCCATGAAAAAATTGTTGTATTTTAGTTTATATATGTCGTTT
rJMFF001F23+ CCTTGGATGAGTTGTAGTCCCATGAAAAAATTGTTGTATTTTAGTTTATATATGTCGTTT
rJMFF035A11+ CCTTGGATGAGTTGTAGTCCCATGAAAAAATTGTTGTATTTTAGTTTATATATGTCGTTT
rJMFF042J06+ CCTTGGATGAGTTGTAGTCCCATGAAAAAATTGTTGTATTTTAGTTTATATATGTCGTTT
                      ____________________________________________________________
consensus CCTTGGATGAGTTGTAGTCCCATGAAAAAATTGTTGTATTTTAGTTTATATATGTCGTTT
 
. : . : . : . : . : . :
rJMSF047G11+ TGATTTCATCAATTTAAGG-TTAAAATAGAGAGATA
rJMFF017N06+ TGATTTCATCAATTTAAGGTTTAAAATAGAGAGATATGAAGTGATATGCAGAT
rJMSF012K10+ TGATTTCATCAATTTAAGGTTTAAAATAGAGAGATATGAAGTGATATGCAGATAATGTT
rJMSF025O06+ TGATTTCATCAATTTAAGGTTTAAAATAGAGAGATACGAAGTGATATGCAGATAATGTTT
rJMFF037J14+ TGATTTCATCAATTTAAGGTTTAAAATAGAGAGATATGAAGTGATATGCAGATAATGTTT
rJMSF015M12+ TGATTTCATCAATTTAAGGTTTAAAATAGAGAGATATGAAGTGATATGCAGATAATGTTT
rJMFF025F11+ TGATTTCATCAATTTAAGGTTTAAAATAGAGAGATATGAAGTGATATGCAGATAATGTTT
rJMFF005J04+ TGATTTCATCAATTTAAGGTTTAAAATAGAGAGATATGAAGTGATATGCAGATAATGTTT
rJMFF036M20+ TGATTTCATCAAT
rJMFF001F23+ TGATTTCATCAATTTAAGGTTTAAAATAGAGAGATATGAAGTGATATGCAGATAATGTTT
rJMFF035A11+ TGATTTCATCAATTTAAGGTTTAAAATAGAGAGATATGAAGTGATATGCAGATAATGTTT
rJMFF042J06+ TGATTTCATCAATTTAAGGTTTAAAATAGAGAGATATGAAGTGATATGCAGATAATGTTT
                      ____________________________________________________________
consensus TGATTTCATCAATTTAAGGTTTAAAATAGAGAGATATGAAGTGATATGCAGATAATGTTT
 
. : . : . : . : . : . :
rJMSF025O06+ GTATGTAAAATCTGTT
rJMFF037J14+ GTATGTAAAATCTGTTTATTGCTAGCTA-TTTTTAATCAAAA
rJMSF015M12+ GTATGTAAAATCTGTT
rJMFF025F11+ GTATGTAAAATCTGTTTATTGCTAGCTA-TTTTTAATCAAA
rJMFF005J04+ GTATGTAAAATCTGTTTATTGCTAGCTA-TTTTTAATCAAAA
rJMFF001F23+ GTATGTAAAATCTGTTTATTGCTAGCTA-TTTTTAATCAAAA
rJMFF035A11+ GTATGTAAAATCTGTTTATTGCTAGCTA-TTTTTAATCAAAA
rJMFF042J06+ GTATGTAAAATCTGTTTATTGCTAGCTATTTTTTAATCAAAATGATGAGTTTACAAGTAT
                      ____________________________________________________________
consensus GTATGTAAAATCTGTTTATTGCTAGCTA-TTTTTAATCAAAATGATGAGTTTACAAGTAT