Previous Contig 010232:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009D14Sequence586014224689010232 (5)gb:AY086585_15716327e-71Arabidopsis thaliana clone 259653 mRNA, complete sequence.
JMFF012P01Sequence491014307pir|T10863|T108630.047extensin precursor - kidney bean>gb:PVU18791_1702996 Phaseolus vulgaris hydroxyp751010232 (5)gb:AY086585_15716321e-78Arabidopsis thaliana clone 259653 mRNA, complete sequence.
JMFF042I24Sequence630014936584010232 (5)gb:AY086585_15716327e-59Arabidopsis thaliana clone 259653 mRNA, complete sequence.
JMFN031N20Sequence614010232 (5)gb:AY086585_15716322e-75Arabidopsis thaliana clone 259653 mRNA, complete sequence.
JMSF046F17Sequence608020346763010232 (5)gb:AY086585_15716321e-76Arabidopsis thaliana clone 259653 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF046F17+ TTATGTCAAGA
                      ____________________________________________________________
consensus TTATGTCAAGA
 
. : . : . : . : . : . :
rJMSF046F17+ TTAAATGATACTCCTTACATTCAACACTCTTTCCTCTATTTGTGTATTGTTTTGACTTCC
                      ____________________________________________________________
consensus TTAAATGATACTCCTTACATTCAACACTCTTTCCTCTATTTGTGTATTGTTTTGACTTCC
 
. : . : . : . : . : . :
JMFN031N20- CAGGAATCTAGTAGTATCTACAAGCTCATAGAGG
rJMSF046F17+ ACACAAATTAACTGAAGTTTTATTTGCAGGAATCTAGTAGTATCTACAAGCTCATAGAGA
rJMFF012P01+ CAGGAATCTAGTAGTATCTACAAGCTCATAGAGA
rJMFF009D14+ CAGGAATNTAGTAGTATNTACAAGCTCATAGAGA
                      ____________________________________________________________
consensus ACACAAATTAACTGAAGTTTTATTTGCAGGAATCTAGTAGTATCTACAAGCTCATAGAGA
 
. : . : . : . : . : . :
JMFN031N20- TCAGCACTGGTGGAAAATTGAGCAGGCATAATATTCATATACAGCAAGTAGGCCCCGACA
rJMSF046F17+ TCAGCACTGGTGGAAAATTGAGCAGGCATAATATTCATATACAGCAAGCAGGCCCCGACA
rJMFF012P01+ TCAGCACTGGTGGAAAATTGAGCAGGCATAATATTCATATACAGCAAGCAGGCCCCGACA
rJMFF009D14+ TCAGCACTGGTGGAAAATTGAGCAGGCATAATATTCATATACAGCAAGCAGGCCCCGACA
                      ____________________________________________________________
consensus TCAGCACTGGTGGAAAATTGAGCAGGCATAATATTCATATACAGCAAGCAGGCCCCGACA
 
. : . : . : . : . : . :
JMFN031N20- CCGTCACTGAATTATCTACTTTTCATTTGTCTGTTACTGATCAAACACAAGATCTACACA
rJMSF046F17+ CCGTCACTGAATTATCTACTTTTCATTTGTCTGTCACTGATCAAACACAAGATCTACACA
rJMFF012P01+ CCGTCACTGAATTATCTACTTTTCATTTGTCTGTCACTGATCAAACACAAGATCTACACA
rJMFF009D14+ CCGTCACTGAATTATCTACTTTTCATTTGTCTGTCACTGATCAAACACAAGATCTACACA
rJMFF042I24+ CTACTTTTCATTTGTCTGTTACTGATCAAACACAAGATCTACACA
                      ____________________________________________________________
consensus CCGTCACTGAATTATCTACTTTTCATTTGTCTGTTACTGATCAAACACAAGATCTACACA
 
. : . : . : . : . : . :
JMFN031N20- GTAAATTAGTGTTGGACCATCCACGGGGTTATTCTCAGCAACTACACAAGTGCATTGTGG
rJMSF046F17+ GTAAATTAGTGTTGGACCATCCACGGGGATATTCTCAGCAACTACACAAGTGCATTGTGG
rJMFF012P01+ GTAAATTAGTGTTGGACCATCCACGGGGATATTCTCAGCAACTACACAAGTGCATTGTGG
rJMFF009D14+ GTAAATTAGTGTTGGACCATCCACGGGGATATTCTCAGCAACTACACAAGTGCATTGTGG
rJMFF042I24+ GTAAATTAGTGTTGGACCATCCACGGGGTTATTCTCAGCAACTACACAAGTGCATTGTGG
                      ____________________________________________________________
consensus GTAAATTAGTGTTGGACCATCCACGGGGTTATTCTCAGCAACTACACAAGTGCATTGTGG
 
. : . : . : . : . : . :
JMFN031N20- CTCATTCATCAGGGCAGGCTGTTTTTGATGGGAATGTTCAGGTGAACAGAAACGCACAGC
rJMSF046F17+ CTCATTCATCAGGGCAGGCTGTTTTTGATGGGAATGTTCAGGTGAACAGAAACGCACAAC
rJMFF012P01+ CTCATTCATCAGGGCAGGCTGTTTTTGATGGGAATGTTCAGGTGANCAGANACGCACAAC
rJMFF009D14+ CTCATTCATCAGGGCAGGCTGTTTTTGATGGGAATGTTCAGGTGAACAGAAACGCACAAC
rJMFF042I24+ CTCATTCATCAGGGCAGGCTGTTTTTGATGGGAATGTTCAGGTGAACAGAAACGCACAGC
                      ____________________________________________________________
consensus CTCATTCATCAGGGCAGGCTGTTTTTGATGGGAATGTTCAGGTGAACAGAAACGCACAGC
 
. : . : . : . : . : . :
JMFN031N20- AAACGGACGCAGGGCAACTTACACGGAGCCTCCTCTTGGAGCCCCGAGCAACTGTGAACG
rJMSF046F17+ AAACGAACGCAGGGCAACTTACACGGAGCCTCCTCTTGGAGCCCCGAGCAAGTGTGAACG
rJMFF012P01+ AAACGAACGCAGGGCAACTTACACGGAGCCTCCTCTTGGAGCCCCGAGCAANTGTGAACG
rJMFF009D14+ AAACGAACGCAGGGCAACTTACACGGAGCCTCCTCTTGGAGCCCCGAGCAAGTGTGAACG
rJMFF042I24+ AAACGGACGCAGGGCAACTTACACGGAGCCTCCTCTTGGAGCCCCGAGCAACTGTGAACG
                      ____________________________________________________________
consensus AAACGGACGCAGGGCAACTTACACGGAGCCTCCTCTTGGAGCCCCGAGCAACTGTGAACG
 
. : . : . : . : . : . :
JMFN031N20- TGAAGCCTAACCTGCAAATTATTGCTGATGATGTTAAGTGCTCCCATGGAGCTGCAATCA
rJMSF046F17+ TGAAGCCTAACCTGCAAATTATTGCTGATGATGTTAAGTGCTCCCATGGAGCTGCAATCA
rJMFF012P01+ TGAAGCCTAACCTGCAAATTATTGCTGATGATGTTAAGTGCTCCCATGGAGCTGCAATCA
rJMFF009D14+ TGAAGCCTAACCTGCAAATTATTGCTGATGATGTTAAGTGCTCCCATGGAGCTGCAATCA
rJMFF042I24+ TGAAGCCTAACCTGCAAATTATTGCTGATGATGTTAAGTGCTCCCATGGAGCTGCAATCA
                      ____________________________________________________________
consensus TGAAGCCTAACCTGCAAATTATTGCTGATGATGTTAAGTGCTCCCATGGAGCTGCAATCA
 
. : . : . : . : . : . :
JMFN031N20- GCGACTTGGAAGAAGACCAGCTGTTTTACTTACAGGCACGGGGTATCGACATAAAAGCTG
rJMSF046F17+ GCGACTTGGAAGAGGACCAGCTCTTTTACTTACAGGCACGGGGTATTGACATAAAAACTG
rJMFF012P01+ GCGACTTGGAAGAGGACCAGCTCTTTTACTTACAGGCACGGGGTATTGACATAAAAACTG
rJMFF009D14+ GCGACTTGGAAGAGGACCAGCTCTTTTACTTACAGGCACGGGGTATTGACATAAAAACTG
rJMFF042I24+ GCGACTTGGAAGAAGACCAGCTGTTTTACTTACAGGCACGGGGTATCGACATAAAAGCTG
                      ____________________________________________________________
consensus GCGACTTGGAAGAGGACCAGCTGTTTTACTTACAGGCACGGGGTATTGACATAAAAGCTG
 
. : . : . : . : . : . :
JMFN031N20- CAAGAAAAGCTCTGG-TTTTTTCCTTTGCAGCCGAGGTGGTTTCCCGTCTCCCAGATGAT
rJMSF046F17+ CAAGAAAAGCTCTGG-TTTTTTCCTTTGCAGCCGAGGTGGTTTCCCGTCTCCCAGATGAT
rJMFF012P01+ CAAGAAAAGCTCTGGTTTTTTTCCTTTGCAGCCGAGGTGGTTTCCCGTCTCCCAGATGAT
rJMFF009D14+ CAAGAAAAGCTCTGGTTTTTTTCCTTTGCAGCCGAGGTGGTTTCCCGTCTCCCAGATGAT
rJMFF042I24+ CAAGAAAAGCTCTGG-TTTTTTCCTTTGCAGCCGAGGTGGTTTCCCGTCTCCCAGATGAT
                      ____________________________________________________________
consensus CAAGAAAAGCTCTGG-TTTTTTCCTTTGCAGCCGAGGTGGTTTCCCGTCTCCCAGATGAT
 
. : . : . : . : . : . :
JMFN031N20- TCCATACG
rJMSF046F17+ TCCATACGAAAGAAAGTTGAGGATCAAATTAGAACACTGCTCGAATCCACCAATCCCAAA
rJMFF012P01+ TCCATACGAAAGAAAGTTGAGGATCAAATTAGAACACTGCTCGAATCCACCAATCCCAAA
rJMFF009D14+ TCCATACGAAAGAAAGTTGAGGATCAAATTAGAACACTGCTCGAATCCACCAATCCCAAA
rJMFF042I24+ TCCATACGAAAGAAAGTTGAAGATCAAATTAGAACACTGCTCGAATCCATCAATCCCAAA
                      ____________________________________________________________
consensus TCCATACGAAAGAAAGTTGAGGATCAAATTAGAACACTGCTCGAATCCACCAATCCCAAA
 
. : . : . : . : . : . :
rJMSF046F17+ CCGTGAGTCTTCATAAATTATTTTGTA
rJMFF012P01+ CCGTGAGTCTTCATAAATTATTTTGTA
rJMFF009D14+ CCGTGAGTCTTCATAAATTATTTTGTA
rJMFF042I24+ CTGTGACTCTTCGTAAATTATTTTGTAGATGTTGTTTATGATTCATTGTATGCTAGAAAA
                      ____________________________________________________________
consensus CCGTGAGTCTTCATAAATTATTTTGTAGATGTTGTTTATGATTCATTGTATGCTAGAAAA
 
. : . : . : . : . : . :
rJMFF042I24+ TTAGAGAAATTGAACGATATGATGATTGTTCAGTCTCGCTTAATTAATTATATTGTTCTT
                      ____________________________________________________________
consensus TTAGAGAAATTGAACGATATGATGATTGTTCAGTCTCGCTTAATTAATTATATTGTTCTT