Previous Contig 010231:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008E06Sequence514010231 (6)gb:AY560860_16149496e-31Arabidopsis thaliana putative AP2/EREBP transcription factor (At5g67190) mRNA, c701010231 (6)gb:AY174160_15868792e-32Gossypium hirsutum DRE binding protein 1 mRNA, complete cds.>gb:AF509502_1807049
JMFF042I22Sequence625010231 (6)gb:AB020742_15145723e-40Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21H1.619010231 (6)gb:AY174160_15868792e-39Gossypium hirsutum DRE binding protein 1 mRNA, complete cds.>gb:AF509502_1807049
JMFF048A08Sequence404010231 (6)gb:AY560860_16149494e-24Arabidopsis thaliana putative AP2/EREBP transcription factor (At5g67190) mRNA, c204010231 (6)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF042I22- GCGTTAGGGAGCGAC-GAAACACTGGAGCTGCTTAAC
JMFF048A08- GTTAGGGAGCGACAGAAACACTGGAGCTGCTTAAC
JMFF008E06- GTTAGGGAGCGACAGAAACACTGGAGCTGCTTAAC
                      ____________________________________________________________
consensus GCGTTAGGGAGCGACAGAAACACTGGAGCTGCTTAAC
 
. : . : . : . : . : . :
JMFF042I22- AAAGCC-AAATTTCATGGGTGTTCTTTCTCTCTCTAAAATTCCTCCAATCGTGGCTTTAG
JMFF048A08- AAAGCCAAAATTTCATGGGTGTTCTTTCTCTCTCTAAAATTCCTCCAATCGTGGCTTTAG
JMFF008E06- AAAGCCAAAATTTCATGGGTGTTCTTTCTCTCTCTAAAATTCCTCCAATCGTGGCTTTAG
                      ____________________________________________________________
consensus AAAGCCAAAATTTCATGGGTGTTCTTTCTCTCTCTAAAATTCCTCCAATCGTGGCTTTAG
 
. : . : . : . : . : . :
JMFF042I22- ATTACAGGGAAAGATAGGATTTAGATACAATCAGTTTATCAGTCGATATATATAGGCAGA
JMFF048A08- ATTACAGGGAAAGATAGGATTTAGATACAATCAGTTTATCAGTCGATATATATAGGCAGA
JMFF008E06- ATTACAGGGAAAGATAGGATTTAGATACAATCAGTTTATCAGTCGATATATATAGGCAGA
rJMFF008E06+ ATAGGCAGA
                      ____________________________________________________________
consensus ATTACAGGGAAAGATAGGATTTAGATACAATCAGTTTATCAGTCGATATATATAGGCAGA
 
. : . : . : . : . : . :
JMFF042I22- TTCACAGCGCATAATTATGAATTTGAAGGGCGAGAAGATGGAGATGGAAGGGGAAGTTGT
JMFF048A08- TTCACAGCGCATAATTATGAATTTGAAGGGCGAGAAGATGGAGATGGAAGGGGAAGTTGT
JMFF008E06- TTCACAGCGCATAATTATGAATTTGAAGGGCGAGAAGATGGAGATGGAAGGGGAAGTTGT
rJMFF008E06+ TTCCCAGNGCATAATTATGAATTTGAAGGGCGAGAAGATGGAGATGGAAGGGGAAGTTGT
                      ____________________________________________________________
consensus TTCACAGCGCATAATTATGAATTTGAAGGGCGAGAAGATGGAGATGGAAGGGGAAGTTGT
 
. : . : . : . : . : . :
JMFF042I22- GGGGTCGTGTTGTTCAGAGAAGAGGAAGAACGAGAGACCTTATAAAGGAATCAGGATGAG
JMFF048A08- GGGGTCGTGTTGTTCAGAGAAGAGGAAGAACGAGAGACCTTATAAAGGAATCAGGATGAG
JMFF008E06- GGGGTCGTGTTGTTCAGAGAAGAGGAAGAACGAGAGACCTTATAAAGGAATCAGGATGAG
rJMFF008E06+ GGGGTNGTGTTGTTCAGAGAAGAGGAAGAACGAGAGNCCTTNTAAAGGAATCAGGATGAG
rJMFF042I22+ TATAAAGGAATCAGGATGAG
                      ____________________________________________________________
consensus GGGGTCGTGTTGTTCAGAGAAGAGGAAGAACGAGAGACCTTATAAAGGAATCAGGATGAG
 
. : . : . : . : . : . :
JMFF042I22- GAAGTGGGGTAAATGGGTGGCCGAAATCAGGGAGCCGAACAAGCGGTCCAGGATATGGTT
JMFF048A08- GAAGTGGGGTAAATGGGTGGCCGAAATCAGGGAGCCGAACAAGCGGTCCAGGATATGGTT
JMFF008E06- GAAGTGGGGTAAATGGGTGGCCGAAATCAGGGAGCCGAACAAGCGGTCCAGGATATGGTT
rJMFF008E06+ GAAGTGGGGTAAATGGGTGGCCGAAATCAGGGAGCCGAACAAGCGGTCCAGGATATGGTT
rJMFF042I22+ GAAGTGGGGTAAATGGGTGGCCGAAATCAGGGAGCCGAACAAGCGGTCCAGGATATGGTT
                      ____________________________________________________________
consensus GAAGTGGGGTAAATGGGTGGCCGAAATCAGGGAGCCGAACAAGCGGTCCAGGATATGGTT
 
. : . : . : . : . : . :
JMFF042I22- AGGATCCTATTCGACGCCGGTAGCGGCGGCGAGAGCCTACGACACCGCCGTCTACTACCT
JMFF048A08- AGGATCCTATTCGACGCCGGTAGCGGCGGCGAGAGCCTACGACACCGCCGTCTACTACCT
JMFF008E06- AGGATCCTATTCGACGCCGGTAGCGGCGGCGAGAGCCTACGACACCGCCGTCTACTACCT
rJMFF008E06+ AGGATCCTATTCGACGCCGGTAGCGGCGGCGAGAGCCTNCGACNCCGCCGTTTNCTACCT
rJMFF042I22+ AGGATCCTATTCGACGCCGGTAGCGGCGGCGAGAGCCTACGACACCGCCGTCTACTACCT
                      ____________________________________________________________
consensus AGGATCCTATTCGACGCCGGTAGCGGCGGCGAGAGCCTACGACACCGCCGTCTACTACCT
 
. : . : . : . : . : . :
JMFF042I22- CCGCGGGCCGTCGGC
JMFF048A08- CCGCGGGCC
JMFF008E06- CCGCGGGCCGTCGGCGCGGTTGAACTTCCCGGAGCTGCTGGGTTAGCGACGGCGCCGGAC
rJMFF008E06+ CCGCGGGCCGTNGGCGCGGTTGAACTTCCCGGAGCTGCT-GGTTAGCGACGGCGCCGGAC
rJMFF042I22+ CCGCGGGCCGTCGGCGCGGTTGAACTTCCCGGAGCTGCT-GGTTAGCGACGGCGCCGGAC
                      ____________________________________________________________
consensus CCGCGGGCCGTCGGCGCGGTTGAACTTCCCGGAGCTGCT-GGTTAGCGACGGCGCCGGAC
 
. : . : . : . : . : . :
JMFF008E06- TCAGCGACTTGTCCGCCGCTTCNATTCGGAAGAGAGCGGTCGAAGTCNGCGCCAGAGTG
rJMFF008E06+ TCAGCGACTTGTCCGCCGCTTNGATTNGGAAGAGAGCGGTNGAAGTCGGCGCCAGAGTGG
rJMFF042I22+ TCAGCGACTTGTCCGCCGCTTCGATTCGGAAGAGAGCGGTCGAAGTCGGCGCCAGAGTGG
                      ____________________________________________________________
consensus TCAGCGACTTGTCCGCCGCTTCGATTCGGAAGAGAGCGGTCGAAGTCGGCGCCAGAGTGG
 
. : . : . : . : . : . :
rJMFF008E06+ ACGCAATCCAAACCTCCCTCGGCGGCCACGACCNCCGCCCCTACAAGCAGCGCGACGGCG
rJMFF042I22+ ACGCAATCCAAACCTCCCTCGGCGGCCACGACCACCGCCCCTACAAGCAGCGCGACGGCG
                      ____________________________________________________________
consensus ACGCAATCCAAACCTCCCTCGGCGGCCACGACCACCGCCCCTACAAGCAGCGCGACGGCG
 
. : . : . : . : . : . :
rJMFF008E06+ AGCGTGAAAGCCCTTGCGCGACTNGACTGAAGCCGTGTTGGTTTCAGGAGAAGCCCGACT
rJMFF042I22+ AGCGTGAAAGCCCTTGCGCGACTCGACTGAAGCCGTGTTGGTTTCAGGAGAAGCCCGACT
                      ____________________________________________________________
consensus AGCGTGAAAGCCCTTGCGCGACTCGACTGAAGCCGTGTTGGTTTCAGGAGAAGCCCGACT
 
. : . : . : . : . : . :
rJMFF008E06+ TGAACGAGAAACCCGAACCCGAAGACCCGGATAGCGGAGATTACTGGTGACTGGTGAGCA
rJMFF048A08+ GATAGCGGAGATTACTGGTGACTGGTGAGCA
rJMFF042I22+ TGAACGAGAAACCCGAACCCGAAGACCCGGATAGCGGAGATTACTGGTGACTGGTGAGCA
                      ____________________________________________________________
consensus TGAACGAGAAACCCGAACCCGAAGACCCGGATAGCGGAGATTACTGGTGACTGGTGAGCA
 
. : . : . : . : . : . :
rJMFF008E06+ ATAAATAAATAAATAAC-AAAAAAAAAATAAAAATTAATTGTACTTTTGTTAGGTTGCGC
rJMFF048A08+ ATAAATAAATAAATAAC-AAAAAAAAAATAAAAATTAATTGTACTTTTGTTAGGTTGCGC
rJMFF042I22+ ATAAATAAATAAATAACAAAAAAAAAAATAAAAATTAATTGTACTTTTGTTAGGTTGCGC
                      ____________________________________________________________
consensus ATAAATAAATAAATAAC-AAAAAAAAAATAAAAATTAATTGTACTTTTGTTAGGTTGCGC
 
. : . : . : . : . : . :
rJMFF008E06+ TGGTAAACAAGCGCCCAGTAGTTTCTTCTTTCATCTGGTAAATTAAACTAGCTAGCCAAG
rJMFF048A08+ TGGTAAACAAGCGCCCAGTAGTTTCTTCTTTCATCTGGTAAATTAAACTAGTTAGCCAAG
rJMFF042I22+ TGGTAAACAAGCGCCCAGTAGTTTCTTCTTTCATCTGGTAAATTAAACTAGCTAGCCAAG
                      ____________________________________________________________
consensus TGGTAAACAAGCGCCCAGTAGTTTCTTCTTTCATCTGGTAAATTAAACTAGCTAGCCAAG
 
. : . : . : . : . : . :
rJMFF008E06+ CTACCTTGTTTTATCTTCTTCATTTTATAAATAT
rJMFF048A08+ CTACCTTGTTTTATCTTCTTCATTTTATAAATATTATTTACCCTAGTTTTTTAC
rJMFF042I22+ CTACCTTGTTTTATCTTCTTCATTTTATAAATATTATTTACCCTAGTTTTTTACTGTTAT
                      ____________________________________________________________
consensus CTACCTTGTTTTATCTTCTTCATTTTATAAATATTATTTACCCTAGTTTTTTACTGTTAT