Previous Contig 010220:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF042G18Sequence622010220 (4)gb:AK117402_18154382e-47Arabidopsis thaliana At3g13700 mRNA for unknown protein, complete cds, clone: RA614010220 (4)gb:AK117402_18154388e-35Arabidopsis thaliana At3g13700 mRNA for unknown protein, complete cds, clone: RA
JMSF018I02Sequence456010220 (4)gb:AK117402_18154389e-37Arabidopsis thaliana At3g13700 mRNA for unknown protein, complete cds, clone: RA742010220 (4)gb:AK117402_18154386e-37Arabidopsis thaliana At3g13700 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF018I02- GACCGAATACTTTTTCTCCGACGAAACTAGCCAC
JMFF042G18- CATGACTCGAGACCGAATACTTTTTCTCCGACGAAACTAGCCAC
                      ____________________________________________________________
consensus CATGACTCGAGACCGAATACTTTTTCTCCGACGAAACTAGCCAC
 
. : . : . : . : . : . :
JMSF018I02- GGGAATTTGTGTAGACTTCGCAGTCTCTATAATTAATCATCTGCCACCGCTACGCTCGAC
JMFF042G18- GGGAATTTGTGTAGACTTCGCAGTCTCTATAATTAATCATCTGCCACCGCTACGCTCGAC
                      ____________________________________________________________
consensus GGGAATTTGTGTAGACTTCGCAGTCTCTATAATTAATCATCTGCCACCGCTACGCTCGAC
 
. : . : . : . : . : . :
JMSF018I02- GACCTCCGACGGAGAGAAGAGATGGCTCTCCACCAGCCCTACGACCCTTACTACCGCCCC
JMFF042G18- GACCTCCGACGGAGAGAAGAGATGGCTCTCCACCAGCCCTACGACCCTTACTACCGCCCC
                      ____________________________________________________________
consensus GACCTCCGACGGAGAGAAGAGATGGCTCTCCACCAGCCCTACGACCCTTACTACCGCCCC
 
. : . : . : . : . : . :
JMSF018I02- CAACCACTACCCATTCCAGATTACGGCTACACCGTCGGTAATAAAAACGAACGCGATATG
JMFF042G18- CAACCACTACCCATTCCAGATTACGGCTACACCGTCGGTAATAAAAACGAACGCGATATG
                      ____________________________________________________________
consensus CAACCACTACCCATTCCAGATTACGGCTACACCGTCGGTAATAAAAACGAACGCGATATG
 
. : . : . : . : . : . :
JMSF018I02- ATTCGAACCCTATTCGTGTCCGGCCTCCCAGACGACGTTAAAGCTCGTGAAATTCACAAT
JMFF042G18- ATTCGAACCCTATTCGTGTCCGGCCTCCCAGACGACGTTAAAGCTCGTGAAATTCACAAT
                      ____________________________________________________________
consensus ATTCGAACCCTATTCGTGTCCGGCCTCCCAGACGACGTTAAAGCTCGTGAAATTCACAAT
 
. : . : . : . : . : . :
JMSF018I02- CTCTTCCGCCGCCGTCCCGGCTTCGAGTCTTGTCAGCTCAAGTACACTGGTCGCGGAGAT
JMFF042G18- CCCTTCCGCCGCCGTCCCGGCTTCGAGTCTTGTCAGCTCAAGTACACTGGTCGCGGAGAT
                      ____________________________________________________________
consensus CTCTTCCGCCGCCGTCCCGGCTTCGAGTCTTGTCAGCTCAAGTACACTGGTCGCGGAGAT
 
. : . : . : . : . : . :
JMSF018I02- CAGGTTGTTGCATTTGCCACCTTTGTAGATCATCAATCAGCAATGGCAGCATTGCACTCG
JMFF042G18- CAGGTTGTTGCATTTGCCACCTTTGTAGATCATCAATCAGCAATGGCAGCATTGCACTCG
                      ____________________________________________________________
consensus CAGGTTGTTGCATTTGCCACCTTTGTAGATCATCAATCAGCAATGGCAGCATTGCACTCG
 
. : . : . : . : . : . :
JMSF018I02- TTAAATGGTGTGAAGTTTGATCCTCAAACAGGATCCACTTTGCACATTGAAATTGCCAGA
JMFF042G18- TTAAATGGTGTGAAGTTTGATCCTCAAACAGGATCCACTTTGCACATTGAAATTGCCAGA
                      ____________________________________________________________
consensus TTAAATGGTGTGAAGTTTGATCCTCAAACAGGATCCACTTTGCACATTGAAATTGCCAGA
 
. : . : . : . : . : . :
JMSF018I02- TC
JMFF042G18- TCAAACTCCAGGAGGACAAAGAGACCAGGGAGTGGGCCCTATGTTGTTATTGATAACAGA
rJMSF018I02+ GGGAGTGGGCCCTATGTTGTTATTGATAACAGA
                      ____________________________________________________________
consensus TCAAACTCCAGGAGGACAAAGAGACCAGGGAGTGGGCCCTATGTTGTTATTGATAACAGA
 
. : . : . : . : . : . :
JMFF042G18- TCTAAATCCAATACAGATGCCAAAGGCACTTCAAGTGATGAAGATTCAAATGATAGTGAT
rJMSF018I02+ TCTAAATCCNATACAGATGCCAAAGGCACTTCAAGTGATGAAGATTCAAATGATAGTGAT
                      ____________________________________________________________
consensus TCTAAATCCAATACAGATGCCAAAGGCACTTCAAGTGATGAAGATTCAAATGATAGTGAT
 
. : . : . : . : . : . :
JMFF042G18- TCTGATGACCCATCAAGATCCAATGATCCTGATTCTGG
rJMSF018I02+ TNTGATGACCCATCAAGATCCAATGATCCTGATTCTGGCAACAATGATGATTCGTNTGAG
                      ____________________________________________________________
consensus TCTGATGACCCATCAAGATCCAATGATCCTGATTCTGGCAACAATGATGATTCGTNTGAG
 
. : . : . : . : . : . :
rJMSF018I02+ AAGAGTGGTGAGAAAGTGGGTGATGGTGATAATGTTTTAGCTGCNCAAAGTGAACAGATT
rJMFF042G18+ AAAGTGAACAGATT
                      ____________________________________________________________
consensus AAGAGTGGTGAGAAAGTGGGTGATGGTGATAATGTTTTAGCTGCNCAAAGTGAACAGATT
 
. : . : . : . : . : . :
rJMSF018I02+ GAGAAAATAGGAGATGGTACTCATCCATGTTCCNCTTTATTTATTGCCAATCTCGGGCCC
rJMFF042G18+ GAGAAAATAGGAGATGGTACTCATCCATGTTCCACTTTATTTATTGCCAATCTCGGGCCC
                      ____________________________________________________________
consensus GAGAAAATAGGAGATGGTACTCATCCATGTTCCACTTTATTTATTGCCAATCTCGGGCCC
 
. : . : . : . : . : . :
rJMSF018I02+ AACTGTACTGAAGATGAACTTAGGAAAATTCTTTCACAGTACCCTGGATTCAACNCCCTG
rJMFF042G18+ AACTGTACTGAAGATGAACTTAGGAAAATTCTTTCACAGTACCCTGGATTCAACACCCTG
                      ____________________________________________________________
consensus AACTGTACTGAAGATGAACTTAGGAAAATTCTTTCACAGTACCCTGGATTCAACACCCTG
 
. : . : . : . : . : . :
rJMSF018I02+ AAGGTTCGTGCTAGAGGTGGAATGCCAGTTGCTTTTGCTGATTTTGAGGGTGTTGAAGAA
rJMFF042G18+ AAGGTTCGTGCTAGAGGTGGAATGCCAGTTGCTTTTGCTGATTTTGAGGGTGTTGAAGAA
                      ____________________________________________________________
consensus AAGGTTCGTGCTAGAGGTGGAATGCCAGTTGCTTTTGCTGATTTTGAGGGTGTTGAAGAA
 
. : . : . : . : . : . :
rJMSF018I02+ GCGACCCAGGTCATGAATGCACTTCAAGGAAGCTCATTGCCTTCGTCAGATCGGGGTGGC
rJMFF042G18+ GCGACCCAGGTCATGAATGCACTTCAAGGAAGCTCATTGCCTTCGTCAGATCGGGGTGGC
                      ____________________________________________________________
consensus GCGACCCAGGTCATGAATGCACTTCAAGGAAGCTCATTGCCTTCGTCAGATCGGGGTGGC
 
. : . : . : . : . : . :
rJMSF018I02+ ATGCATATAGAATATGCTAGATNTAAAATGAGGAAGCCTTGAATCACNTTACGGTAAAAA
rJMFF042G18+ ATGCATATAGAATATGCTAGATCTAAAATGAGGAAGCCTTGAATCACATTACGGTAAAAA
                      ____________________________________________________________
consensus ATGCATATAGAATATGCTAGATCTAAAATGAGGAAGCCTTGAATCACATTACGGTAAAAA
 
. : . : . : . : . : . :
rJMSF018I02+ AAAAACTTATATTCTGGTGTCCATTAGCTATGACTTCAATGCTCACATAGATTTAGTCCC
rJMFF042G18+ AAAAACTTATATTCTGGTGTCCATTAGCTATGACTTCAATGCTCACATAGATTTAGTCCC
                      ____________________________________________________________
consensus AAAAACTTATATTCTGGTGTCCATTAGCTATGACTTCAATGCTCACATAGATTTAGTCCC
 
. : . : . : . : . : . :
rJMSF018I02+ TAAATCAAAGCCTTTTCTATCATGATAAGTGTCAAGTATGAAACAGTGGATTTTTGTCAA
rJMFF042G18+ TAAATCAAAGCCTTTTCTATCATGATAAGTGTCAAGTATGAAACAGTGGATTTTTGTCAA
                      ____________________________________________________________
consensus TAAATCAAAGCCTTTTCTATCATGATAAGTGTCAAGTATGAAACAGTGGATTTTTGTCAA
 
. : . : . : . : . : . :
rJMSF018I02+ AGTAGTTCACGAAGAACTGATATAGGCCACCCAGTTAATTTATGCTATCACTTCATTATT
rJMFF042G18+ AGTAGTTCACGAAGAACTGATATAGGCCACCCAGTTAATTTATGCTATCACTTCATTATT
                      ____________________________________________________________
consensus AGTAGTTCACGAAGAACTGATATAGGCCACCCAGTTAATTTATGCTATCACTTCATTATT
 
. : . : . : . : . : . :
rJMSF018I02+ AAGTACAACTTGAAAGATGATATCAGTTCCTTCCTTAATCTCTGTATCT
rJMFF042G18+ AAGTACAACTTGAAAGATGATATCAGTTCCTTCCTTAATCTCTGTATCTGAATTCGAATA
                      ____________________________________________________________
consensus AAGTACAACTTGAAAGATGATATCAGTTCCTTCCTTAATCTCTGTATCTGAATTCGAATA
 
. : . : . : . : . : . :
rJMFF042G18+ ATATTTGTACATTGCTAGAAACTGTTTTTTCCACCATGCAATGCAACACTTGTCAGGTCT
                      ____________________________________________________________
consensus ATATTTGTACATTGCTAGAAACTGTTTTTTCCACCATGCAATGCAACACTTGTCAGGTCT