Previous Contig 010201:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011O01Sequence594010201 (6)731010201 (6)pir|T05238|T052383e-13hypothetical protein F18A5.80 - Arabidopsis thaliana>gb:ATCHRIV37_1545133 Arabid
JMFF042C13Sequence659010201 (6)595010201 (6)pir|T05238|T052382e-13hypothetical protein F18A5.80 - Arabidopsis thaliana>gb:ATCHRIV37_1545133 Arabid
JMFF044H17Sequence613010201 (6)607010201 (6)pir|T05238|T052382e-13hypothetical protein F18A5.80 - Arabidopsis thaliana>gb:ATCHRIV37_1545133 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF011O01- AATCCGCGCAGCGGGGCAGCGCTCCATTCCTTCAACTTT
                      ____________________________________________________________
consensus AATCCGCGCAGCGGGGCAGCGCTCCATTCCTTCAACTTT
 
. : . : . : . : . : . :
JMFF011O01- CCTCTTCCGCCCTTCTATTCGGTCAAATGGGAGCAATAAAGATGTAGAAATCAAAAATCC
                      ____________________________________________________________
consensus CCTCTTCCGCCCTTCTATTCGGTCAAATGGGAGCAATAAAGATGTAGAAATCAAAAATCC
 
. : . : . : . : . : . :
JMFF011O01- CAGTGAGAAGTGTCCAAAAATTTCTCTCTCGGACTTCCTCAACAAAAAATTGCACAAAAG
                      ____________________________________________________________
consensus CAGTGAGAAGTGTCCAAAAATTTCTCTCTCGGACTTCCTCAACAAAAAATTGCACAAAAG
 
. : . : . : . : . : . :
JMFF011O01- TTCTGTTCTTTCCGGTTCAGTTCAGAGGAAGGAGAAGCAATTTCTGTCGCCAGTGGGCAG
JMFF044H17- CAGAGGAAGGAGAAGCAATTTCTGTCGCCAGTGGGCAG
JMFF042C13- CAGAGGAAGGAGAAGCAATTTCTGTCGCCAGTGGGCAG
                      ____________________________________________________________
consensus TTCTGTTCTTTCCGGTTCAGTTCAGAGGAAGGAGAAGCAATTTCTGTCGCCAGTGGGCAG
 
. : . : . : . : . : . :
JMFF011O01- CAAGGACGCTATAAGATTCCCTAAAGAAAATGGAAATAGCAAGGAAAAAGATTGTGCTCT
JMFF044H17- CAAGGACGCTATAAGATTCCCTAAAGAAAATGGAAATAGCAAGGAAAAAGATTGTGCTCT
JMFF042C13- CAAGGACGCTATAAGATTCCCTAAAGAAAATGGAAATAGCAAGGAAAAAGATTGTGCTCT
rJMFF011O01+ AAATGGAAATAGCAAGGAAAAAGATTGTGCTCT
                      ____________________________________________________________
consensus CAAGGACGCTATAAGATTCCCTAAAGAAAATGGAAATAGCAAGGAAAAAGATTGTGCTCT
 
. : . : . : . : . : . :
JMFF011O01- TGATGTTATACTTGAAAAGCTTAAGCCATCTGATAAAGGGGAAGAACATGGTGATAGAGG
JMFF044H17- TGATGTTATACTTGAAAAGCTTAAGCCATCTGATAAAGGGGAAGAACATGGTGATAGAGG
JMFF042C13- TGATGTTATACTTGAAAAGCTTAAGCCATCTGATAAAGGGGAAGAACATGGTGATAGAGG
rJMFF011O01+ TGATGTTATACTTGAAAAGCTTAAGCCATCTGATAAAGGGGAAGAACATGGTGATAGAGG
                      ____________________________________________________________
consensus TGATGTTATACTTGAAAAGCTTAAGCCATCTGATAAAGGGGAAGAACATGGTGATAGAGG
 
. : . : . : . : . : . :
JMFF011O01- TAGTGGTTGTGATGATGAAGCTGTGATTTCTAGCACAGAAGATACGGAAGTATCAAGGAA
JMFF044H17- TAGTGGTTGTGATGATGAAGCTGTGATTTCTAGCACAGAAGATACGGAAGTATCAAGGAA
JMFF042C13- TAGTGGTTGTGATGATGAAGCTGTGATTTCTAGCACAGAAGATACGGAAGTATCAAGGAA
rJMFF011O01+ TAGTGGTTGTGATGATGAAGCTGTGATTTCTAGCACAGAAGATACGGAAGTATCAAGGAA
rJMFF044H17+ CAAGGAA
                      ____________________________________________________________
consensus TAGTGGTTGTGATGATGAAGCTGTGATTTCTAGCACAGAAGATACGGAAGTATCAAGGAA
 
. : . : . : . : . : . :
JMFF011O01- GAGAAGAAATGTGTTTGAAGGTTAGTCAATTTCTTCCCAAATGTAATCATTTACGTCTGT
JMFF044H17- GAGAAGAAATGTGTTTGAAGGTTAGTCAATTTCTTCCCAAATGTAATCATTTACGTCTGT
JMFF042C13- GAGAAGAAATGTGTTTGAAGGTTAGTCAATTTCTTCCCAAATGTAATCATTTACGTCTGT
rJMFF011O01+ GAGAAGAAATGTGTTTGAAGGTTAGTCAATTTCTTCCCAAATGTAATCATTTACGTCTGT
rJMFF044H17+ GAGAAGAAATGTGTTTGAAGGTTAGTCAATTTCTTCCCAAATGTAATCATTTACGTCTGT
rJMFF042C13+ GAAATGTGTTTGAAGGTTAGTCAATTTCTTCCCAAATGTAATCATTTACGTCTGT
                      ____________________________________________________________
consensus GAGAAGAAATGTGTTTGAAGGTTAGTCAATTTCTTCCCAAATGTAATCATTTACGTCTGT
 
. : . : . : . : . : . :
JMFF011O01- TTTTAGCATGTCTGTGTGATTGTAGCAAACCGGCAAACCATTCTGCTAATATGATGTATT
JMFF044H17- TTTTAGCATGTCTGTGTGATTGTAGCAAACCGGCAAACCATTCTGCTAATATGATGTATT
JMFF042C13- TTTTAGCATGTCTGTGTGATTGTAGCAAACCGGCAAACCATTCTGCTAATATGATGTATT
rJMFF011O01+ TTTTAGCATGTCTGTGTGATTGTAGCAAACCGGCAAACCATTCTGCTAATATGATGTATT
rJMFF044H17+ TTTTAGCATGTCTGTGTGATTGTAGCAAACCGGCAAACCATTCTGCTAATATGATGTATT
rJMFF042C13+ TTTTAGCATGTCTGTGTGATTGTAGCAAACCGGCAAACCATTCTGCTAATATGATGTATT
                      ____________________________________________________________
consensus TTTTAGCATGTCTGTGTGATTGTAGCAAACCGGCAAACCATTCTGCTAATATGATGTATT
 
. : . : . : . : . : . :
JMFF011O01- ATTTGCCTCATCACTATTCACTATACATCTTATGTTTTGAATTACAAGGTAATGATGACG
JMFF044H17- ATTTGCCTCATCACTATTCACTATACATCTTATGTTTTGAATTACAAGGTAATGATGACG
JMFF042C13- ATTTGCCTCATCACTATTCACTATACATCTTATGTTTTGAATTACAAGGTAATGATGACG
rJMFF011O01+ ATTTGCCTCATCACTATTCACTATACATCTTATGTTTTGAATTACAAGGTAATGATGACG
rJMFF044H17+ ATTTGCCTCATCACTATTCACTATACATCTTATGTTTTGAATTACAAGGTAATGATGACG
rJMFF042C13+ ATTTGCCTCATCACTATTCACTATACATCTTATGTTTTGAATTACAAGGTAATGATGACG
                      ____________________________________________________________
consensus ATTTGCCTCATCACTATTCACTATACATCTTATGTTTTGAATTACAAGGTAATGATGACG
 
. : . : . : . : . : . :
JMFF011O01- GGCAATCTGCTCGAA
JMFF044H17- GGCAATCTGCTCG-AAGGTTCTTGTAGTCTTGGGA
JMFF042C13- GGCAATCTGCTCGAAAGGTTCTTGTAGTCTTGGGAGGGGATTCAAAGAATAAGCAAAGCA
rJMFF011O01+ GGCAATCTGCTCGAAAGGTTCTTGTAGTCTTGGGAGGGGATTCAAAGAATAAGCAAAGCA
rJMFF044H17+ GGCAATCTGCTCGAAAGGTTCTTGTAGTCTTGGGAGGGGATTCAAAGAATAAGCAAAGCA
rJMFF042C13+ GGCAATCTGCTCGAAAGGTTCTTGTAGTCTTGGGAGGGGATTCAAAGAATAAGCAAAGCA
                      ____________________________________________________________
consensus GGCAATCTGCTCGAAAGGTTCTTGTAGTCTTGGGAGGGGATTCAAAGAATAAGCAAAGCA
 
. : . : . : . : . : . :
JMFF042C13- GAAAAGGGAAGAGTCATGCC
rJMFF011O01+ GAAAAGGGAAGAGTCATGCCACTGTTGAGAAACCAGCTAACTACTTCAATCATTATGCAA
rJMFF044H17+ GAAAAGGGAAGAGTCATGCCACTGTTGAGAAACCAGCTAACTACTTCAATCATTATGCAA
rJMFF042C13+ GAAAAGGGAAGAGTCATGCCACTGTTGAGAAACCAGCTAACTACTTCAATCATTATGCAA
                      ____________________________________________________________
consensus GAAAAGGGAAGAGTCATGCCACTGTTGAGAAACCAGCTAACTACTTCAATCATTATGCAA
 
. : . : . : . : . : . :
rJMFF011O01+ ATGGAGGTGGGTGGTGGGATTATGGGAAGGAAGGGGTTGACAATGAAGAAGTGGGATGCA
rJMFF044H17+ ATGGAGGTGGGTGGTGGGATTATGGGAAGGAAGGGGTTGACAATGAAGAAGTGGGATGCA
rJMFF042C13+ ATGGAGGTGGGTGGTGGGATTATGGGAAGGAAGGGGTTGACAATGAAGAAGTGGGATGCA
                      ____________________________________________________________
consensus ATGGAGGTGGGTGGTGGGATTATGGGAAGGAAGGGGTTGACAATGAAGAAGTGGGATGCA
 
. : . : . : . : . : . :
rJMFF011O01+ ATGAAATGTGGGAAGGAAGGGGATGTACCACCTTAGGTGGACTTGATTGGCATTGATTTA
rJMFF044H17+ ATGAAATGTGGGAAGGAAGGGGATGTACCACCTTAGGTGGACTTGATTGGCATTGATTTA
rJMFF042C13+ ATGAAATGTGGGAAGGAAGGGGATGTACCACCTTAGGTGGACTTGATTGGCATTGATTTA
                      ____________________________________________________________
consensus ATGAAATGTGGGAAGGAAGGGGATGTACCACCTTAGGTGGACTTGATTGGCATTGATTTA
 
. : . : . : . : . : . :
rJMFF011O01+ CATTTGGTCTTAGATAAACTGCATATGATACCTATTGTAAGATAATTTGACTAAAGTGGT
rJMFF044H17+ CATTTGGTCTTAGATAAACTGCATATGATACCTATTGTAAGATAATTTGACTAAAGTGGT
rJMFF042C13+ CATTTGGTCTTAGATAAACTGCATATGATACCTATTGTAAGATAATTTGACTAAAGTGGT
                      ____________________________________________________________
consensus CATTTGGTCTTAGATAAACTGCATATGATACCTATTGTAAGATAATTTGACTAAAGTGGT
 
. : . : . : . : . : . :
rJMFF011O01+ GTCATTAAAGCATGGTTTGAACTTGAAATGTGGTAGATTTCCACCTGAACTTTCTTGTAT
rJMFF044H17+ GTCATTAAAGCATGGTTTGAACTTGAAATGTGGTAGATTTCCACCTGAACTTTCTTGTAT
rJMFF042C13+ GTCATTAAAGCATGGTTTGAACTTGAAATGTGGTAGATTTCCACCTGAACTTTCTTGTAT
                      ____________________________________________________________
consensus GTCATTAAAGCATGGTTTGAACTTGAAATGTGGTAGATTTCCACCTGAACTTTCTTGTAT
 
. : . : . : . : . : . :
rJMFF011O01+ AATATTATCAGATGATTCCTATTATCAGGATTAGATAT
rJMFF044H17+ AATATTATCAGATGATTCCTATTATCAGGATTAGATATGATGATAGTAACATTTTCAACT
rJMFF042C13+ AATATTATCAGATGATTCCTATTATCAGGATTAGATATGATGATAGTAACATTTTCAACT
                      ____________________________________________________________
consensus AATATTATCAGATGATTCCTATTATCAGGATTAGATATGATGATAGTAACATTTTCAACT