Previous Contig 010199:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004O18Sequence496000411 (15)gb:AY372071_16032232e-75Nicotiana tabacum heat shock protein 70-3 (HSP70-3) gene, complete cds.747010199 (16)gb:CSA249331_16738052e-71Cucumis sativus mRNA for heat shock protein 70 isoform-2.
JMFF008A01Sequence536000411 (15)gb:AY372071_16032235e-82Nicotiana tabacum heat shock protein 70-3 (HSP70-3) gene, complete cds.665010199 (16)gb:CSA249331_16738057e-91Cucumis sativus mRNA for heat shock protein 70 isoform-2.
JMFF008G06Sequence666010199 (16)gb:CSA249331_16738054e-43Cucumis sativus mRNA for heat shock protein 70 isoform-2.
JMFF009C16Sequence542000411 (15)gb:AY372071_16032236e-85Nicotiana tabacum heat shock protein 70-3 (HSP70-3) gene, complete cds.714010199 (16)gb:CSA249331_16738052e-65Cucumis sativus mRNA for heat shock protein 70 isoform-2.
JMFF009E22Sequence492000411 (15)gb:AY372071_16032236e-75Nicotiana tabacum heat shock protein 70-3 (HSP70-3) gene, complete cds.717010199 (16)gb:CSA249331_16738057e-77Cucumis sativus mRNA for heat shock protein 70 isoform-2.
JMFF012F10Sequence543000411 (15)gb:AY372071_16032236e-85Nicotiana tabacum heat shock protein 70-3 (HSP70-3) gene, complete cds.802010199 (16)gb:CSA249331_16738057e-95Cucumis sativus mRNA for heat shock protein 70 isoform-2.
JMFF013H06Sequence568000710 (5)pir|S46302|S463022e-86dnaK-type molecular chaperone hsc70.1 - Arabidopsis thaliana>gb:ATHSC70_1553377 728010199 (16)gb:CSA249331_1673805e-100Cucumis sativus mRNA for heat shock protein 70 isoform-2.
JMFF020I07Sequence495000411 (15)gb:AY372071_16032232e-85Nicotiana tabacum heat shock protein 70-3 (HSP70-3) gene, complete cds.674010199 (16)gb:CSA249331_16738054e-68Cucumis sativus mRNA for heat shock protein 70 isoform-2.
JMFF025H18Sequence548000411 (15)gb:AY372071_16032236e-85Nicotiana tabacum heat shock protein 70-3 (HSP70-3) gene, complete cds.781010199 (16)gb:CSA249331_16738051e-78Cucumis sativus mRNA for heat shock protein 70 isoform-2.
JMFF029E03Sequence453000411 (15)sp|P27322|HS72_LYCES3e-68Heat shock cognate 70 kDa protein 2.>pir|S14950|S14950 dnaK-type molecular chape726010199 (16)gb:CSA249331_16738051e-78Cucumis sativus mRNA for heat shock protein 70 isoform-2.
JMFF031N19Sequence495000411 (15)gb:AY372071_16032236e-75Nicotiana tabacum heat shock protein 70-3 (HSP70-3) gene, complete cds.719010199 (16)gb:CSA249331_16738052e-76Cucumis sativus mRNA for heat shock protein 70 isoform-2.
JMFF036K12Sequence539000411 (15)gb:AY372071_16032232e-84Nicotiana tabacum heat shock protein 70-3 (HSP70-3) gene, complete cds.705010199 (16)gb:CSA249331_16738051e-78Cucumis sativus mRNA for heat shock protein 70 isoform-2.
JMFF037H08Sequence142000411 (15)gb:AF527796_18084154e-07Cucurbita maxima cell-autonomous heat shock cognate protein 70 (Hsc70-3) mRNA, c727010199 (16)gb:CSA249331_16738053e-77Cucumis sativus mRNA for heat shock protein 70 isoform-2.
JMFF042C07Sequence652000411 (15)gb:AY372071_1603223e-105Nicotiana tabacum heat shock protein 70-3 (HSP70-3) gene, complete cds.603010199 (16)gb:CSA249331_16738051e-40Cucumis sativus mRNA for heat shock protein 70 isoform-2.
JMSF003L14Sequence424000411 (15)sp|P27322|HS72_LYCES4e-63Heat shock cognate 70 kDa protein 2.>pir|S14950|S14950 dnaK-type molecular chape748010199 (16)gb:CSA249331_16738051e-78Cucumis sativus mRNA for heat shock protein 70 isoform-2.
JMSF040I04Sequence711000411 (15)pir|S53126|S53126e-111dnaK-type molecular chaperone hsp70 - rice (fragment)858010199 (16)gb:CSA249331_1673805e-101Cucumis sativus mRNA for heat shock protein 70 isoform-2.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF013H06+ ACTCCGACAACCA
rJMSF040I04+ GACAACCA
                      ____________________________________________________________
consensus ACTCCGACAACCA
 
. : . : . : . : . : . :
rJMFF013H06+ GCCTGGTGTGTTGATTCAGGTCTATGAAGGTGAGAGGACAAGGACCAGGGACAACAACTT
rJMFF012F10+ GGTGTGTTGATTCAGGTCTATGAAGGTGAGAGGACAAGGACCAGGGACANCAACTT
rJMFF008A01+ AGGACAAGGACCAGGGACAACAACTT
rJMSF040I04+ GCCTGGTGTGTTGATTCAGGTCTATGAAGGTGAGAGGACAAGGACCAGGGACAACAACTT
                      ____________________________________________________________
consensus GCCTGGTGTGTTGATTCAGGTCTATGAAGGTGAGAGGACAAGGACCAGGGACAACAACTT
 
. : . : . : . : . : . :
rJMFF013H06+ GCTTGGAAAATTTGAGCTCTCCGGCATCCCTCCTGCACCTAGGGGTGTTCCTCAGATCAC
rJMFF012F10+ GCTTGGAAAATTTGAGCTCTCCGGCATCCNTCCTGCACNTAGGGGTGTTCCTCAGATCAC
rJMFF008A01+ GCTTGGAAAATTTGAGCTCTCCGGCATCCCTCCTGCACNTAGGGGTGTTCCTCAGATCAC
rJMSF040I04+ GCTTGGAAAATTTGAGCTCTCCGGCATCCCTCCTGCACCTAGGGGTGTTCCTCAGATCAC
rJMSF003L14+ TAGGGGTGTTCCTCAGATCAC
rJMFF029E03+ TAGGGGTGTTCCTCAGATCAC
rJMFF037H08+ TAGGGGTGTTCCTCAGATCAC
rJMFF009E22+ TCCTCAGATCAC
rJMFF031N19+ TTCCTCAGATCAC
rJMFF036K12+ TAGGGGTGTTCCTCAGATCAC
rJMFF025H18+ TAGGGGTGTTCCTCAGATCAC
                      ____________________________________________________________
consensus GCTTGGAAAATTTGAGCTCTCCGGCATCCCTCCTGCACCTAGGGGTGTTCCTCAGATCAC
 
. : . : . : . : . : . :
rJMFF013H06+ AGTCTGCTTTGATATTGATGCCAATGGTATCTTAAATGTATCTGCTGAGGACAAGACTAC
rJMFF012F10+ AGTCTGCTTTGATATTGATGCCAATGGTATCTTAAATGTATCTGCTGAGGACAAGACTAC
rJMFF008A01+ AGTCTGCTTTGATATTGATGCCAATGGTATCTTAAATGTATCTGCTGAGGACAAGACTAC
rJMSF040I04+ AGTCTGCTTTGATATTGATGCCAATGGTATCTTAAATGTATCTGCTGAGGACAAGACTAC
rJMSF003L14+ AGTCTGCTTTGATATTGATGCCAATGGTATCTTAAATGTATCTGCTGAGGACAAGACTAC
rJMFF029E03+ AGTCTGCTTTGATATTGATGCCAATGGTATCTTAAATGTATCTGCTGAGGACAAGACTAC
rJMFF037H08+ AGTCTGCTTTGATATNGATGCCAATGGTATCTTAAATGTATCTGCTGAGGACAAGACTAC
rJMFF009E22+ AGTCTGCTTTGATATTGATGCCAATGGTATCTTAAATGTATCTGCTGAGGACAAGACTAC
rJMFF031N19+ AGTCTGCTTTGATATTGATGCCAATGGTATCTTAAATGTATCTGCTGAGGACAAGACTAC
rJMFF036K12+ AGTCTGCTTTGATATTGATGCCAATGGTATCTTAAATGTATCTGCTGAGGACAAGACTAC
rJMFF025H18+ AGTCTGCTTTGATATTGATGCCAATGGTATCTTAAATGTATCTGCTGAGGACAAGACTAC
rJMFF020I07+ CTTAAATGTATCTGCTGAGGACAAGACTAC
rJMFF004O18+ TATTGATGCCAATGGTATCTTAAATGTATCTGCTGAGGACAAGACTAC
rJMFF009C16+ GAGGACAAGACTAC
                      ____________________________________________________________
consensus AGTCTGCTTTGATATTGATGCCAATGGTATCTTAAATGTATCTGCTGAGGACAAGACTAC
 
. : . : . : . : . : . :
rJMFF013H06+ CGGTCAAAAGAACAAGATCACCATCACAAATGACAAGGGCAGTCTTTCAAAGGAGGAGAT
rJMFF012F10+ CGGTCAAAAGAACAAGATCACCATCACAAATGACAAGGGCAGACTTTCAAAGGAGGAGAT
rJMFF008A01+ CGGTCAAAAGAACAAGATCACCATCACAAATGACAAGGGCAGACTTTCAAAGGAGGAGAT
rJMSF040I04+ CGGTCAAAAGAACAAGATCACCATCACAAATGACAAGGGCAGACTTTCAAAGGAGGAGAT
rJMSF003L14+ CGGTCAAAAGAACAAGATCACCATCACAAATGACAAGGGCAGACTTTCAAAGGAGGAGAT
rJMFF029E03+ CGGTCAAAAGAACAAGATCACCATCACAAATGACAAGGGCAGACTTTCAAAGGAGGAGAT
rJMFF037H08+ CGGTCAAAAGAACAAGATCACCATCACAAATGACAAGGGCAGACTTTCAAAGGAGGAGAT
rJMFF009E22+ CGGTCAAAAGAACAAGATCACCATCACAAATGACAAGGGCAGACTTTCAAAGGAGGAGAT
rJMFF031N19+ CGGTCAAAAGAACAAGATCACCTTCACAAATGACAAGGGCAGACTTTCAAAGGAGGAGAT
rJMFF036K12+ CGGTCAAAAGAACAAGATCACCATCACAAATGACAAGGGCAGACTTTCAAAGGAGGAGAT
rJMFF025H18+ CGGTCAAAAGAACAAGATCACCATCACAAATGACAAGGGCAGACTTTCAAAGGAGGAGAT
rJMFF020I07+ CGGTCAAAAGAACAAGATCACCATCACAAATGACAAGGGCAGACTTTCAAAGGAGGAGAT
rJMFF008G06+ CAAATGACAAGGGCAGANTTTCANAGGAGGAGAT
rJMFF004O18+ CGGTCAAAAGAACAAGATCACCATCACAAATGACAAGGGCAGACTTTCAAAGGAGGAGAT
rJMFF009C16+ CGGTCAAAAGAACAAGATCACCATCACAAATGACAAGGGCAGACTTTCAAAGGAGGAGAT
                      ____________________________________________________________
consensus CGGTCAAAAGAACAAGATCACCATCACAAATGACAAGGGCAGACTTTCAAAGGAGGAGAT
 
. : . : . : . : . : . :
rJMFF013H06+ TGAGAAGATGGTACAAGAAGCCGAGAAATACAAGTCTGAGGATGAAGATCACAAGAAGAA
rJMFF012F10+ TGAGAAGATGGTACAAGAAGCCGAGAAATACAAGTCTGAGGATGAAGATCACAAGAAGAA
rJMFF008A01+ TGAGAAGATGGTACAAGAAGCCGAGAAATACAAGTCTGAGGATGAAGATCACAAGAAGAA
rJMSF040I04+ TGAGAAGATGGTACAAGAAGCCGAGAAATACAAGTCTGAGGATGAAGATCACAAGAAGAA
rJMSF003L14+ TGAGAAGATGGTACAAGAAGCCGAGAAATACAAGTCTGAGGATGAAGATCACAAGAAGAA
rJMFF029E03+ TGAGAAGATGGTACAAGAAGCCGAGAAATACAAGTCTGAGGATGAAGATCACAAGAAGAA
rJMFF037H08+ TGAGAAGATGGTACAAGAAGCCGAGAAATACAAGTCTGAGGATGAAGATCACAAGAAGAA
rJMFF009E22+ TGAGAAGATGGTACAAGAAGCCGAGAAATACAAGTCTGAGGATGAAGATCACAAGAAGAA
rJMFF031N19+ TGAGAAGATGGTACAAGAAGCCGAGAAATACAAGTCTGAGGATGAAGATCACAAGAAGAA
rJMFF036K12+ TGAGAAGATGGTACAAGAAGCCGAGAAATACAAGTCTGAGGATGAAGATCACAAGAAGAA
rJMFF025H18+ TGAGAAGATGGTACAAGAAGCCGAGAAATACAAGTCTGAGGATGAAGATCACAAGAAGAA
rJMFF020I07+ TGAGAAGATGGTACAAGAAGCCGAGAAATACAAGTCTGAGGATGAAGATCACAAGAAGAA
rJMFF008G06+ TGAGAAGATGGTACAAGAAGCCGAGANATACAAGTCTGAGGATGNAGATCACAAGANGAA
rJMFF004O18+ TGAGAAGATGGTACAAGAAGCCGAGAAATACAAGTCTGAGGATGAAGATCACAAGAAGAA
rJMFF009C16+ TGAGAAGATGGTACAAGAAGCCGAGAAATACAAGTCTGAGGATGAAGATCACAAGAAGAA
rJMFF042C07+ AAGAA
                      ____________________________________________________________
consensus TGAGAAGATGGTACAAGAAGCCGAGAAATACAAGTCTGAGGATGAAGATCACAAGAAGAA
 
. : . : . : . : . : . :
rJMFF013H06+ GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGAGGAACACTGTGAATGA
rJMFF012F10+ GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGAGGAACACTGTGAATGA
rJMFF008A01+ GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGAGGAACACTGTGAATGA
rJMSF040I04+ GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGAGGAACACTGTGAATGA
rJMSF003L14+ GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGAGGAACACTGTGAATGA
rJMFF029E03+ GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGAGGAACACTGTGAATGA
rJMFF037H08+ GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGGGGAACACTGTGAATGA
rJMFF009E22+ GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGAGGAACACTGTGAATGA
rJMFF031N19+ GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGAGGAACACTGTGAATGA
rJMFF036K12+ GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGAGGAACACTGTGAATGA
rJMFF025H18+ GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGAGGAACACTGTGAATGA
rJMFF020I07+ GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGAGGAACACTGTGAATGA
rJMFF008G06+ GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGAGGAACACTGTGAATGA
rJMFF004O18+ GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGAGGAACACTGTGAATGA
rJMFF009C16+ GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGAGGAACACTGTGAATGA
rJMFF042C07+ GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGAGGAACACTGTGAATGA
                      ____________________________________________________________
consensus GGTTGAGGCCAAAAACGCTTTGGAGAACTACTCATACAACATGAGGAACACTGTGAATGA
 
. : . : . : . : . : . :
rJMFF013H06+ TGATAAGATTGGAT-CTAAGCTTGCCCCAGCAGACAAGAAGAAGATTGAGGATGCCATTG
rJMFF012F10+ TGATAAGATTGGAT-CTAAGCTTGCCCCAGCAGACAAGAAGAAGATTGAGGATGCCATTG
rJMFF008A01+ TGATAAGATTGGAT-CTAAGCTTGCCCCAGCAGACAAGAAGAAGATTGAGGATGCCATTG
rJMSF040I04+ TGATAAGATTGGAT-CTAAGCTTGCCCCAGCAGACAAGAAGAAGATTGAGGATGCCATTG
rJMSF003L14+ TGATAAGATTGGAT-CTAAGCTTGCCCCAGCAGACAAGAAGAAGATTGAGGATGCCATTG
rJMFF029E03+ TGATAAGATTGGAT-CTAAGCTTGCCCCAGCAGACAAGAAGAAGATTGAGGATGCCATTG
rJMFF037H08+ TGATAAGATTGGAT-CTAAGCTTGCCCCAGCAGACAAGAAGAAGATTGAGGATGCCATTG
rJMFF009E22+ TGATAAGATTGGAT-CTAAGCTTGCCCCAGCAGACAAGAAGAAGATTGAGGATGCCATTG
rJMFF031N19+ TGATAAGATTGGAT-CTAAGCTTGCCCCAGCAGACAAGAAGAAGATTGAGGATGCCATTG
rJMFF036K12+ TGATAAGATTGGAT-CTAAGCTTGCCCCAGCAGACAAGAAGAAGATTGAGGATGCCATTG
rJMFF025H18+ TGATAAGATTGGAT-CTAAGCTTGCCCCAGCAGACAAGAAGAAGATTGAGGATGCCATTG
rJMFF020I07+ TGATAAGATTGGAT-CTAAGCTTGCCCCAGCAGACAAGAAGAAGATTGAGGATGCCATTG
rJMFF008G06+ TGATAAGATNGGATCCTAANCTTGCCCCAGCAGACAAGANGAAGATTGNGGATGCCATTG
rJMFF004O18+ TGATAAGATTGGAT-CTAAGCTTGCCCCAGCAGACAAGAAGAAGATTGAGGATGCCATTG
rJMFF009C16+ TGATAAGATTGGAT-CTAAGCTTGCCCCAGCAGACAAGAAGAAGATTGAGGATGCCATTG
rJMFF042C07+ TGATAAGATTGGAT-CTAAGCTTGCCCCAGCAGACAAGAAGAAGATTGAGGATGCCATTG
                      ____________________________________________________________
consensus TGATAAGATTGGAT-CTAAGCTTGCCCCAGCAGACAAGAAGAAGATTGAGGATGCCATTG
 
. : . : . : . : . : . :
rJMFF013H06+ AGCAGACCATCCAATGGCTCGATGGAAACCAGCTTGCTGAGTCAGATGAATTCGAGGACA
rJMFF012F10+ AGCAGACCATCCAATGGCTCGATGGAAACCAGCTTGCTGAGTCAGATGAATTCGAGGACA
rJMFF008A01+ AGCAGACCATCCAATGGCTCGATGGAAACCAGCTTGCTGAGTCAGATGAATTCGAGGACA
rJMSF040I04+ AGCAGACCATCCAATGGCTCGATGGAAACCAGCTTGCTGAGTCAGATGAATTCGAGGACA
rJMSF003L14+ AGCAGACCATCCAATGGCTCGATGGAAACCAGCTTGCTGAGTCAGATGAATTCGAGGACA
rJMFF029E03+ AGCAGACCATCCAATGGCTCGATGGAAACCAGCTTGCTGAGTCAGATGAATTCGAGGACA
rJMFF037H08+ AGCAGACCATCCAATGGCTCGATGGAAACCAGCTTGCTGAGTCAGATGAATTCGAGGACA
rJMFF009E22+ AGCAGACCATCCAATGGCTCGATGGAAACCAGCTTGCTGAGTCAGATGAATTCGAGGACA
rJMFF031N19+ AGCAGACCATCCAATGGCTCGATGGAAACCAGCTTGCTGAGTCAGATGAATTCGAGGACA
rJMFF036K12+ AGCAGACCATCCAATGGCTCGATGGAAACCAGCTTGCTGAGTCAGATGAATTCGAGGACA
rJMFF025H18+ AGCAGACCATCCAATGGCTCGATGGAAACCAGCTTGCTGAGTCAGATGAATTCGAGGACA
rJMFF020I07+ AGCAGACCATCCAATGGCTCGATGGAAACCAGCTTGCTGAGTCAGATGAATTCGAGGACA
rJMFF008G06+ AGCAGACCATCCAATGGCTCGANGGAAACCAGCTTGNTGAGTCAGATGAATTCGAGGACA
rJMFF004O18+ AGCAGACCATCCAATGGCTCGATGGAAACCAGCTTGCTGAGTCAGATGAATTCGAGGACA
rJMFF009C16+ AGCAGACCATCCAATGGCTCGATGGAAACCAGCTTGCTGAGTCAGATGAATTCGAGGACA
rJMFF042C07+ AGCAGACCATCCAATGGCTCGATGGAAACCAGCTTGCTGAGTCAGATGAATTCGAGGACA
                      ____________________________________________________________
consensus AGCAGACCATCCAATGGCTCGATGGAAACCAGCTTGCTGAGTCAGATGAATTCGAGGACA
 
. : . : . : . : . : . :
rJMFF013H06+ AAATGAAGGAACTCGAAGGCATCTGCAACCCAATCATTGCAAAGATGTACCAAGGTGCTG
rJMFF012F10+ AAATGAAGGAACTCGAAGGCATCTGCAACCCAATCATTGCAAAGATGTACCAAGGTGCTG
rJMFF008A01+ AAATGAAGGAACTCGAAGGCATCTGCAACCCAATCATTGCAAAGATGTACCAAGTTGCTG
rJMSF040I04+ AAATGAAGGAACTCGAAGGCATCTGCAACCCAATCATTGCAAAGATGTACCAAGGTGCTG
rJMSF003L14+ AAATGAAGGAACTCGAAGGCATCTGCAACCCAATCATTGCAAAGATGTACCAAGGTGCTG
rJMFF029E03+ AAATGAAGGAACTCGAAGGCATCTGCAACCCAATCATTGCAAAGATGTACCAAGGTGCTG
rJMFF037H08+ AAATGAAGGAACTCGAAGGCATCTGCAACCCAATCATTGCAAAGATGTACCAAGGTGCTG
rJMFF009E22+ AAATGAAGGAACTCGAAGGCATCTGCAACCCAATCATTGCAAAGATGTACCAAGGTGCTG
rJMFF031N19+ AAATGAAGGAACTCGAAGGCATCTGCAACCCAATCATTGCAAAGATGTACCAAGGTGCTG
rJMFF036K12+ AAATGAAGGAACTCGAAGGCATCTGCAACCCAATCATTGCAAAGATGTACCAAGGTGCTG
rJMFF025H18+ AAATGAAGGAACTCGAAGGCATCTGCAACCCAATCATTGCAAAGATGTACCAAGGTGCTG
rJMFF020I07+ AAATGAAGGAACTCGAAGGCATCTGCAACCCAATCATTGCAAAGATGTACCAAGGTGCTG
rJMFF008G06+ AAATGAAGGAACTNGAAGGCATCTGCAACCCAATCATTGCAANGATGTACCAAGGTGCTG
rJMFF004O18+ AAATGAAGGAACTCGAAGGCATCTGCAACCCAATCATTGCAAAGATGTACCAAGGTGCTG
rJMFF009C16+ AAATGAAGGAACTCGAAGGCATCTGCAACCCAATCATTGCAAAGATGTACCAAGGTGCTG
rJMFF042C07+ AAATGAAGGAACTCGAAGGCATCTGCAACCCAATCATTGCAAAGATGTACCAAGGTGCTG
                      ____________________________________________________________
consensus AAATGAAGGAACTCGAAGGCATCTGCAACCCAATCATTGCAAAGATGTACCAAGGTGCTG
 
. : . : . : . : . : . :
rJMFF013H06+ GTGGTGACATGGGTGGAGCCATGGGCGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
rJMFF012F10+ GTGGTGACATGGGTGGAGCCATGGGCGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
rJMFF008A01+ GTGGTGACATGGGTGGAGCCATGGGCGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
rJMSF040I04+ GTGGTGACATGGGTGGAGCCATGGGCGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
rJMSF003L14+ GTGGTGACATGGGTGGAGCCATGGGCGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
rJMFF029E03+ GTGGTGACATGGGTGGAGCCATGGGCGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
rJMFF037H08+ GTGGTGACATGGGTGGAGCCATGGGCGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
rJMFF009E22+ GTGGTGACATGGGTGGAGCCATGGGCGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
rJMFF031N19+ GTGGTGACATGGGTGGAGCCATGGGCGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
rJMFF036K12+ GTGGTGACATGGGTGGAGCCATGGGCGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
rJMFF025H18+ GTGGTGACATGGGTGGAGCCATGGGCGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
rJMFF020I07+ GTGGTGACATGGGTGGAGCCATGGGCGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
rJMFF008G06+ GTGGTGNCATGGGTGGAGCCATGGGTGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
rJMFF004O18+ GTGGTGACATGGGTGGAGCCATGGGCGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
rJMFF009C16+ GTGGTGACATGGGTGGAGCCATGGGCGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
rJMFF042C07+ GTGGTGACATGGGTGGAGCCATGGGCGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
                      ____________________________________________________________
consensus GTGGTGACATGGGTGGAGCCATGGGCGACGATGCTCCTTCTCACGGTGGTAGTGAGGCTG
 
. : . : . : . : . : . :
rJMFF013H06+ GCCCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
rJMFF012F10+ GCCCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
rJMFF008A01+ GCCCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
rJMSF040I04+ GCCCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
rJMSF003L14+ GCCCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
rJMFF029E03+ GCCCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
rJMFF037H08+ GCCCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
rJMFF009E22+ GCCCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
rJMFF031N19+ GCCCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
rJMFF036K12+ GCCCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
rJMFF025H18+ GCCCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
rJMFF020I07+ GCCCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
rJMFF008G06+ NCNCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
rJMFF004O18+ GCCCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
rJMFF009C16+ GCCCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
rJMFF042C07+ GCCCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
                      ____________________________________________________________
consensus GCCCGAAGATTGAGGAGGTGGACTAAGTTCACGGTGTTTCTATCCTGTTTTGTTTCATTG
 
. : . : . : . : . : . :
rJMFF013H06+ CTTTTAGGATCTATTCACTTGTTTATGATGATGAACTTTTGGGTTTTTTAAAAATC
rJMFF012F10+ CTTTTAGGATCTATTCAC-TGTTTATGATGATGAACTTTTGGGTTTTTTAAAAATCTGTT
rJMFF008A01+ CTTTTAGGATCTATTCAC-TGTTTATGATGATGAACTTTTG
rJMSF040I04+ CTTTTAGGATCTATTCAC-TGTTTATGATGATGAACTTTTGGGTTTTTTAAAAATCTGTT
rJMSF003L14+ CTTTTAGGATCTATTCAC-TGTTTATGATGATGAACTTTTGGGTTTTTTAAAAATCTGTT
rJMFF029E03+ CTTTTAGGATCTATTCAC-TGTTTATGATGATGAACTTTTGGGTTTTTTAAAAATCTGTT
rJMFF037H08+ CTTTTAGGATCTATTCAC-TGTTTATGATGATGAACTTTTGGGTTTTTTAAAAATCTGTT
rJMFF009E22+ CTTTTAGGATCTATTCAC-TGTTTATGATGATGAACTTTTGGGTTTTTTAAAAATCTGTT
rJMFF031N19+ CTTTTAGGATCTATTCAC-TGTTTATGATGATGAACTTTTGGGTTTTTTAAAAATCTGTT
rJMFF036K12+ CTTTTAGGATCTATTCAC-TGTTTATGATGATGAACTTTTGGGTTTTTTAAAAATCTGTT
rJMFF025H18+ CTTTTAGGATCTATTCAC-TGTTTATGATGATGAACTTTTGGGTTTTTTAAAAATCTGTT
rJMFF020I07+ CTTTTAGGATCTATTCAC-TGTTTATGATGATGAACTTTTGGGTTTTTTAAAAATCTGTT
rJMFF008G06+ CTTTTAGGATNTATTCAC-TGTTTATGATGATGAACTTTTGGGTNTTTTAAAAATCTGTT
rJMFF004O18+ CTTTTAGGATCTATTCAC-TGTTTATGATGATGAACTTTTGGGTTTTTTAAAAATCTGTT
rJMFF009C16+ CTTTTAGGATCTATTCAC-TGTTTATGATGATGAACTTTTGGGTTTTTTAAAAATCTGTT
rJMFF042C07+ CTTTTAGGATCTATTCAC-TGTTTATGATGATGAACTTTTGGGTTTTTTAAAAATCTGTT
                      ____________________________________________________________
consensus CTTTTAGGATCTATTCAC-TGTTTATGATGATGAACTTTTGGGTTTTTTAAAAATCTGTT
 
. : . : . : . : . : . :
rJMFF012F10+ TTGATGGGTCTATTTTTGGCAAAGTATATAGGTTGCAGGCTAGACATTTTGGTTGGTGTT
rJMSF040I04+ TTGATGGGTCTATTTTTGGCAAAGTATATAGGTTGCAGGCTAGACATTTTGGTTGGTGTT
rJMSF003L14+ TTGATGGGTCTATTTTTGGCAAAGTATATAGGTTGCAGGCTAGACATTTTGGTTGGTGTT
rJMFF029E03+ TTGATGGGTCTATTTTTGGCAAAGTATATAGGTTGCAGGCTAGACATTTTGGTTGGTGTT
rJMFF037H08+ TTGATGGGTCTATTTTTGGCAAAGTATATAGGTTGCAGGCTAGACATTTTGGTTGGTGTT
rJMFF009E22+ TTGATGGGTCTATTTTTGGCAAAGTATATAGGTTGCAGGCTAGACATTTTGGTTGGTGTT
rJMFF031N19+ TTGATGGGTCTATTTTTGGCAAAGTATATAGGTTGCAGGCTAGACATTTTGGTTGGTGTT
rJMFF036K12+ TTGATGGGTCTATTTTTGGCAAAGTATATAGGTTGCAGGCTAGACATTTTGGTTGGTGTT
rJMFF025H18+ TTGATGGGTCTATTTTTGGCAAAGTATATAGGTTGCAGGCTAGACATTTTGGTTGGTGTT
rJMFF020I07+ TTGATGGGTCTATTTTTGGCAAAGTATATAGGTTGCAGGCTAGACATTTTGGTTGGTGTT
rJMFF008G06+ NTGANGGGTCTATTTTTGGCAAAGTATATAGGTTGCAGGNTAGACATTTTGGTTGGTGTT
rJMFF004O18+ TTGATGGGTCTATTTTTGGCAAAGTATATAGGTTGCAGGCTAGACATTTTGGTTGGTGTT
rJMFF009C16+ TTGATGGGTCTATTTTTGGCAAAGTATATAGGTTGCAGGCTAGACATTTTGGTTGGTGTT
rJMFF042C07+ TTGATGGGTCTATTTTTGGCAAAGTATATAGGTTGCAGGCTAGACATTTTGGTTGGTGTT
                      ____________________________________________________________
consensus TTGATGGGTCTATTTTTGGCAAAGTATATAGGTTGCAGGCTAGACATTTTGGTTGGTGTT
 
. : . : . : . : . : . :
rJMFF012F10+ TGTAATCTGGATAATCTATATACCGTAT
rJMSF040I04+ TGTAATCTGGATAATCTATATACCGTATTCATGCTGCCATTTAAGTATGTCTATGGCGGC
rJMSF003L14+ TGTAATCTGGATAATCTATATACCGTATTCATGCTGCCATTTAAGTATGTCTATGGCGGC
rJMFF029E03+ TGTAATCTGGATAATCTATATACCGTATTCATGCTGCCATTTAAGTA
rJMFF037H08+ TGTAATCTGGATAATCTATATACCGTATTCATGCTGCCATTTAAGTAT
rJMFF009E22+ TGTAATCTGGATAATCTATATACCGTATTCATGCTGCCATTTAAGTA
rJMFF031N19+ TGTAATCTGGATAATCTATATACCGTATTCATGCTGCCATTTAAGTA
rJMFF036K12+ TGTAATCTGGATAATCTATATACCG
rJMFF025H18+ TGTAATCTGGATAATCTATATACCGTATTCATGCTGCCATTTAAGTATGTCTATGGCGGC
rJMFF020I07+ TGTAATCTGGATAATCTATATACCGTATTCATGCTGCCATTTAAGT
rJMFF008G06+ AGTAATCTGGATAATCTATATACCGTATTCATGCTGCCATTTAAGTATGTCTATGNCGGC
rJMFF004O18+ TGTAATCTGGATAATCTATATACCGTATTCATGCTGCCATTTAAGTATGTCTATGGCGGC
rJMFF009C16+ TGTAATCTGGATAATCTATATACCGTATTCATGCTGCCATTTAAGTATGTCTATGGCGGC
rJMFF042C07+ TGTAATCTGGATAATCTATATACCGTATTCATGCTGCCATTTAAGTATGTCTATGGCGGC
                      ____________________________________________________________
consensus TGTAATCTGGATAATCTATATACCGTATTCATGCTGCCATTTAAGTATGTCTATGGCGGC
 
. : . : . : . : . : . :
rJMSF040I04+ CATTTTGC
rJMSF003L14+ CATTTTGCT
rJMFF025H18+ CATTTTGCTTGTTTACATCCGCATTTATATCAATCTCATT
rJMFF008G06+ CATTTTGCTTGTNTACATCCGCATTTATATCAA
rJMFF004O18+ CATTTTGCTTGTTTACATCCGCATTTATATCAATCTCATT
rJMFF009C16+ CATTTTGCTTGTTTACATCCGCATTTATATCAATCTCATT
rJMFF042C07+ CATTTTGCTTGTTTACATCCGCATTTATATCAATCTCATTTCGATTTTTTACATTTGCCC
                      ____________________________________________________________
consensus CATTTTGCTTGTTTACATCCGCATTTATATCAATCTCATTTCGATTTTTTACATTTGCCC