Previous Contig 010196:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF042C01Sequence657005935 (5)gb:AF083759_17669898e-55Arabidopsis thaliana clone sps626 unknown mRNA.243010196 (3)
JMSF020O22Sequence683005935 (5)gb:AF083759_17669892e-60Arabidopsis thaliana clone sps626 unknown mRNA.103010196 (3)
JMSF042H19Sequence770005935 (5)gb:AF083759_17669892e-56Arabidopsis thaliana clone sps626 unknown mRNA.102010196 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF042C01+ ATT
                      ____________________________________________________________
consensus ATT
 
. : . : . : . : . : . :
rJMSF020O22+ TTTTT
rJMSF042H19+ TTTTT
rJMFF042C01+ CTTTTGTAAGGTTTTGGGATTACCCCGTTATTGTTGGACGGGATTCTTTTCCCCTTTTTT
                      ____________________________________________________________
consensus CTTTTGTAAGGTTTTGGGATTACCCCGTTATTGTTGGACGGGATTCTTTTCCCCTTTTTT
 
. : . : . : . : . : . :
rJMSF020O22+ TTTTTGGTCCCCATTCTTTTCCACAGAGATTGCTGTGAAGTATGCATGTAATCTGTTGGA
rJMSF042H19+ TTTTTGGTCCCCATTCTTTTCCACAGAGATTGCTGTGAAGTATGCATGTAATCTG-TGGA
rJMFF042C01+ TTTTTGGTCCCCCTTCTTTTCCCCAAAGATTGCTGTGAAGTATGCATGTAATCTGTTGGA
                      ____________________________________________________________
consensus TTTTTGGTCCCCATTCTTTTCCACAGAGATTGCTGTGAAGTATGCATGTAATCTGTTGGA
 
. : . : . : . : . : . :
rJMSF020O22+ AATTAAATGACTTCAT
rJMSF042H19+ AATTAAATGACTTCAT
rJMFF042C01+ AATTAAATGACTTCATTGAAGCTTTTTAGCTTTTTATATATGTAAAACAGTCTTTAATTT
                      ____________________________________________________________
consensus AATTAAATGACTTCATTGAAGCTTTTTAGCTTTTTATATATGTAAAACAGTCTTTAATTT
 
. : . : . : . : . : . :
rJMFF042C01+ TGAGAAGTTTTCATATAAGGGGGTTCTCAAAAGGATGAAAGGTGTGAGATGAAGTTCCGT
                      ____________________________________________________________
consensus TGAGAAGTTTTCATATAAGGGGGTTCTCAAAAGGATGAAAGGTGTGAGATGAAGTTCCGT