Previous Contig 010195:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF042B11Sequence467010195 (4)gb:AY085653_15707212e-08Arabidopsis thaliana clone 16625 mRNA, complete sequence.314010195 (4)
JMFF042F11Sequence522010195 (4)gb:OSJN00025_16935217e-16Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0029H02, complete seque522010195 (4)gb:OSJN00025_16935217e-16Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0029H02, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF042B11- TACAGGCGCGAAGAGAGCATCCTTTGCACTACCAAC
rJMFF042F11+ TGCAGCATACGAACGCCCTAATTACAGGTGCGAAGAGAGCAT-CTTTGCACTACCAAC
JMFF042F11- TGCAGCATACGAACGCCCTAATTACAGGTGCGAAGAGAGCAT-CTTTGCACTACCAAC
                      ____________________________________________________________
consensus TGCAGCATACGAACGCCCTAATTACAGGTGCGAAGAGAGCAT-CTTTGCACTACCAAC
 
. : . : . : . : . : . :
JMFF042B11- GAGAAGCGGAGAAATGC-ACACGGGGATGGAAACGTGCGAAGAAGCTAGAGAACGGGCTC
rJMFF042F11+ GAGAAGCGGAGAAATGCAACACGGGGATGGAAACGTGCGAAGAAGCTAGAGAAAGGGCTC
JMFF042F11- GAGAAGCGGAGAAATGCAACACGGGGATGGAAACGTGCGAAGAAGCTAGAGAAAGGGCTC
                      ____________________________________________________________
consensus GAGAAGCGGAGAAATGCAACACGGGGATGGAAACGTGCGAAGAAGCTAGAGAAAGGGCTC
 
. : . : . : . : . : . :
JMFF042B11- AAGCGGCATTAATAGTAGAGCGCAAGCTCTCCGAACTGTGGGAGAGTCGGGCCAGGGATT
rJMFF042F11+ AAGCGGCATTAATAGTAGAGCGCAAGCTCTCCGAACTGTGGGAGAGTCGGGCCAGGGATT
JMFF042F11- AAGCGGCATTAATAGTAGAGCGCAAGCTCTCCGAACTGTGGGAGAGTCGGGCCAGGGATT
                      ____________________________________________________________
consensus AAGCGGCATTAATAGTAGAGCGCAAGCTCTCCGAACTGTGGGAGAGTCGGGCCAGGGATT
 
. : . : . : . : . : . :
JMFF042B11- ACGGGTGGAATGATGATGAGTAAAAGAGCTTATTCAAGAAACACACTTTTAGGCATTTGA
rJMFF042F11+ ACGGGTGGAATGATGATGAGTAAAAGAGCTTATTCAAGAAACACACTTTTAGGCATTTGA
JMFF042F11- ACGGGTGGAATGATGATGAGTAAAAGAGCTTATTCAAGAAACACACTTTTAGGCATTTGA
rJMFF042B11+ GGCATTTGA
                      ____________________________________________________________
consensus ACGGGTGGAATGATGATGAGTAAAAGAGCTTATTCAAGAAACACACTTTTAGGCATTTGA
 
. : . : . : . : . : . :
JMFF042B11- AAATTTTCCTGATAGTTTTTAGAGTTTTCATTGCACGCAAACTTAGACTTGGTATCACTA
rJMFF042F11+ AAATTTTCCTGATAGTTTTTAGAGTTTTCATTGCACGCAAACTTAGACTTGGTAGCAGTA
JMFF042F11- AAATTTTCCTGATAGTTTTTAGAGTTTTCATTGCACGCAAACTTAGACTTGGTAGCAGTA
rJMFF042B11+ AAATTTTCCTGATGTTTTTTAGAGTAATCATTGCAGGCAAGTTTTGACTGGGTAGCAGTA
                      ____________________________________________________________
consensus AAATTTTCCTGATAGTTTTTAGAGTTTTCATTGCACGCAAACTTAGACTTGGTAGCAGTA
 
. : . : . : . : . : . :
JMFF042B11- AGTCACCCATATCCTGTGAATATACTTTTTTTTTTTTTTGGCCACGAGGAGCTCTCTTCT
rJMFF042F11+ AGTAACCCATAT-CTGTGAATATAGTTTTTTTTTTTTTTGGTCAGGAGGAGCTTTCTT-T
JMFF042F11- AGTAACCCATAT-CTGTGAATATAGTTTTTTTTTTTTTTGGTCAGGAGGAGCTTTCTT-T
rJMFF042B11+ AGTAACCCATAT-CGGTGAATATAGTTTTTGTTTTTTTTGGTCAGGAGGAGCTTTCTT-T
                      ____________________________________________________________
consensus AGTAACCCATAT-CTGTGAATATAGTTTTTTTTTTTTTTGGTCAGGAGGAGCTTTCTT-T
 
. : . : . : . : . : . :
JMFF042B11- GCTTGCTTCCTTTTACAGCTCCACATC-TCTGAAAATTCCCTTGAAATGGCAACTGAACC
rJMFF042F11+ GTTTGTTTCATTTTAGAGTT-TACATC-TCTGAAGATTCCATTGAAATGGAAAATGAACC
JMFF042F11- GTTTGTTTCATTTTAGAGTT-TACATC-TCTGAAGATTCCATTGAAATGGAAAATGAACC
rJMFF042B11+ GGTTGTTTCATTTTAGAGTT-TACATCTTGTGAAGATTCCATTGAAATGGAAAATGAACC
                      ____________________________________________________________
consensus GTTTGTTTCATTTTAGAGTT-TACATC-TCTGAAGATTCCATTGAAATGGAAAATGAACC
 
. : . : . : . : . : . :
JMFF042B11- TCACGGGGTTCCCCTGTGTTTTTAGC
rJMFF042F11+ TGAGGGGGTTCCCCTGTGTTTTTAGCATTTACTGCCAGTGGGTATTGTGAGATGCTGTTT
JMFF042F11- TGAGGGGGTTCCCCTGTGTTTTTAGCATTTACTGCCAGTGGGTATTGTGAGATGCTGTTT
rJMFF042B11+ TGAGGGGGTTCCCCTGTGTTTTTAGCATGTACTACCAGTGGGTATTATGAGATGCTGTAT
                      ____________________________________________________________
consensus TGAGGGGGTTCCCCTGTGTTTTTAGCATTTACTGCCAGTGGGTATTGTGAGATGCTGTTT
 
. : . : . : . : . : . :
rJMFF042F11+ TGATCAAAGTTCTCTCAGTTCCAAGAAAATTGAATGTGAATTATT
JMFF042F11- TGATCAAAGTTCTCTCAGTTCCAAGAAAATTGAATGTGAATTATT
rJMFF042B11+ TGAGCAAAGTTCTTTCAGGTCCATGAAAATTGGAGGTGAATTATTGCTCAAAAAAAAAAA
                      ____________________________________________________________
consensus TGATCAAAGTTCTCTCAGTTCCAAGAAAATTGAATGTGAATTATTGCTCAAAAAAAAAAA