Previous Contig 010193:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019O18Sequence540001001 (3)gb:AF049353_17640356e-51Nicotiana tabacum alpha-expansin precursor (Nt-EXPA4) mRNA, complete cds.685010193 (5)gb:AB099925_15261592e-35Malus x domestica MdEXPA4 mRNA for expansin, partial cds.
JMFF042B09Sequence619001001 (3)gb:AF049353_17640357e-61Nicotiana tabacum alpha-expansin precursor (Nt-EXPA4) mRNA, complete cds.657010193 (5)gb:AB099925_15261598e-26Malus x domestica MdEXPA4 mRNA for expansin, partial cds.
JMFS002A01Sequence526010193 (5)gb:CAR489608_16453432e-05Cicer arietinum mRNA for alpha-expansin 3 (expa3 gene).
JMFS151C12Sequence602010193 (5)gb:CAR489609_16453444e-17Cicer arietinum mRNA for alpha-expansin 4 (expa4 gene).
JMSF002E12Sequence392001001 (3)gb:AF049353_17640354e-24Nicotiana tabacum alpha-expansin precursor (Nt-EXPA4) mRNA, complete cds.568010193 (5)gb:CAR489609_16453442e-13Cicer arietinum mRNA for alpha-expansin 4 (expa4 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF019O18+ CTGGTACTGGTCACCAATGTGGGCGGCGCCGGCGACGTCCACTCGGTGGAGGTGA
                      ____________________________________________________________
consensus CTGGTACTGGTCACCAATGTGGGCGGCGCCGGCGACGTCCACTCGGTGGAGGTGA
 
. : . : . : . : . : . :
rJMFF019O18+ GGGGTTCAAGGACGGCATGGCAGCCGATGTCGAGGAACTGGGGGCAAAATTGGCAAAGC-
JMFS151C12+ AAAATTGGCAAAGC-
rJMSF002E12+ GGGGGCAAAATTGGCAAAGCA
rJMFF042B09+ GGGTTCAAGGACGGCATGGCAGCCGATGTCGAGGAACTGGGGGCAAAATTGGCAAAGC-
                      ____________________________________________________________
consensus GGGGTTCAAGGACGGCATGGCAGCCGATGTCGAGGAACTGGGGGCAAAATTGGCAAAGC-
 
. : . : . : . : . : . :
rJMFF019O18+ AACGCCAACCTTAACGGCCAGGCTTTGTCGTTCAAGGTAACCACCAGCGACGGCCGCAGC
JMFS002A01+ CAGC
JMFS151C12+ AACGCCAACCTTAACGGCCAGGCTTTGTCGTTCAAGGTAACCACCAGCGACGGCCGCAGC
rJMSF002E12+ AACGCCAACCTTAACGGCCAGGCTTTGTCGTTCAAGGTAACCACCAGNGACGNCCGCAGC
rJMFF042B09+ AACGCCAACCTTAACGGCCAGGCTTTGTCGTTCAAGGTAACCACCAGCGACGGCCGCAGC
                      ____________________________________________________________
consensus AACGCCAACCTTAACGGCCAGGCTTTGTCGTTCAAGGTAACCACCAGCGACGGCCGCAGC
 
. : . : . : . : . : . :
rJMFF019O18+ TTGGTGTCCAACAATGTCGCCCCCGCCGGCTGGTCTTTCGGTCAAACTTACTCCGGCGCC
JMFS002A01+ TTGGTGTCCAACAATGTCGCCCCCGCCGGCTGGTCTTTCGGTCAAACTTACTCCGGCGCC
JMFS151C12+ TTGGTGTCCAACAATGTCGCCCCCGCCGGCTGGTCTTTCGGTCAAACTTACTCCGGCGCC
rJMSF002E12+ TTGGTGTCCAACAATGTCGCCCCCGCCGGCTGGTCTTTCGGTCAAACTTACTCCGGCGCC
rJMFF042B09+ TTGGTGTCCAACAATGTCGCCCCCGCCGGCTGGTCTTTCGGTCAAACTTACTCCGGCGCC
                      ____________________________________________________________
consensus TTGGTGTCCAACAATGTCGCCCCCGCCGGCTGGTCTTTCGGTCAAACTTACTCCGGCGCC
 
. : . : . : . : . : . :
rJMFF019O18+ CAATTCCGTTGAGAACCGCCGCCATTAATTACCTCAGAAAACTCCCACCGATTAAGCGTT
JMFS002A01+ CAATTCCGTTGAGAACCGCCGCCATTAATTACCTCAGAAAACTCCCACCGATTAAGCGTT
JMFS151C12+ CAATTCCGTTGAGAACCGCCGCCATTAATTACCTCAGAAAACTCCCACCGATTAAGCGTT
rJMSF002E12+ CAATTCCGTTGAGAACCGCCGCCATTAATTACCTCAGAAAACTCCCACCGATTAAGCGTT
rJMFF042B09+ CAATTCCGTTGAGAACCGCCGCCATTAATTACCTCAGAAAACTCCCACCGATTAAGCGTT
                      ____________________________________________________________
consensus CAATTCCGTTGAGAACCGCCGCCATTAATTACCTCAGAAAACTCCCACCGATTAAGCGTT
 
. : . : . : . : . : . :
rJMFF019O18+ TCATATAATTATAGTAGTAGGTGTGTCAGTAGTAGTAGTAGACTAGTAGTATTGTGACCG
JMFS002A01+ TCATATAATTATAGTAGTAGGTGTGTCAGTAGTAGTAGTAGACTAGTAGTATTGTGACCG
JMFS151C12+ TCATATAATTATAGTAGTAGGTGTGTCAGTAGTAGTAGTAGACTAGTAGTATTGTGACCG
rJMSF002E12+ TCATATAATTATAGTAGTAGGTGTGTCAGTAGTAGTAGTAGACTAGTAGTATNGTGACCG
rJMFF042B09+ TCATATAATTATAGTAGTAGGTGTGTCAGTAGTAGTAGTAGACTAGTAGTATTGTGACCG
                      ____________________________________________________________
consensus TCATATAATTATAGTAGTAGGTGTGTCAGTAGTAGTAGTAGACTAGTAGTATTGTGACCG
 
. : . : . : . : . : . :
rJMFF019O18+ AGTGTAGGGTCAAAATGGGAAGGCTAAGTTTAAAACAGCCTTCTGGGTTTGTGGGGTACC
JMFS002A01+ AGTGTAGGGTCAAAATGGGAAGGCTAAGTTTAAAACAGCCTTCTGGGTTTGTGGGGTACC
JMFS151C12+ AGTGTAGGGTCAAAATGGGAAGGCTAAGTTTAAAACAGCCTTCTGGGTTTGTGGGGTACC
rJMSF002E12+ AGTGTAGGGTCAAAATGGGAAGGCTAAGTTTAAAACAGCCTTCTGGGTTTGTGGGGTACC
rJMFF042B09+ AGTGTAGGGTCAAAATGGGAAGGCTAAGTTTAAAACAGCCTTCTGGGTTTGTGGGGTACC
                      ____________________________________________________________
consensus AGTGTAGGGTCAAAATGGGAAGGCTAAGTTTAAAACAGCCTTCTGGGTTTGTGGGGTACC
 
. : . : . : . : . : . :
rJMFF019O18+ CTAGTTTATCAAGGGTATACCCAATTCTTGAGGCCAGTGGTTTTTGGCCCGTTCTTTTTT
JMFS002A01+ CTAGTTTATCAAGGGTATACCCAATTCTTGAGGCCAGTGGTTTTTGGCCCGTTCTTTTTT
JMFS151C12+ CTAGTTTATCAAGGGTATACCCAATTCTTGAGGCCAGTGGTTTTTGGCCCGTTCTTTTTT
rJMSF002E12+ CTAGTTTATCAAGGGTATACCCAATTCTTGAGGCCAGTGGTTNTTGGCCCGTTCTTTTNT
rJMFF042B09+ CTAGTTTATCAAGGGTATACCCAATTCTTGAGGCCAGTGGTTTTTGGCCCGTTCTTTTTT
                      ____________________________________________________________
consensus CTAGTTTATCAAGGGTATACCCAATTCTTGAGGCCAGTGGTTTTTGGCCCGTTCTTTTTT
 
. : . : . : . : . : . :
rJMFF019O18+ ATTTTTTATTTTGGTGTTTTTCCTTCTAC--TAAAAGTAGAAGGTGCCGTGGTGGTCTCT
JMFS002A01+ ATTTTTTATTTTGGTGTTTTTCCTTCTACTATAAAAGTAGAAGGTGCCGTGGTGGTCTCT
JMFS151C12+ ATTTTTTATTTTGGTGTTTTTCCTTCTACTATAAAAGTAGAAGGTGCCGTGGTGGTCTCT
rJMSF002E12+ ATTTTTTATTTTGGTGTTTTTCCTTCTACTATAAAAGTAGAAGGTGCCGTGGTGGTCTCT
rJMFF042B09+ ATTTTTTATTTTGGTGTTTTTCCTTCTACTATAAAAGTAGAAGGTGCCGTGGTGGTCTCT
                      ____________________________________________________________
consensus ATTTTTTATTTTGGTGTTTTTCCTTCTACTATAAAAGTAGAAGGTGCCGTGGTGGTCTCT
 
. : . : . : . : . : . :
rJMFF019O18+ TTTACCACCCGCTGATATTAGGTTTAATGAGTGGTTTTACTATATAGTTGAATCATATTT
JMFS002A01+ TTTACCACCCGCTGATATTAGGTTTAATGAGTGGTTTTACTATATAGTTGAATCATATTT
JMFS151C12+ TTTACCACCCGCTGATATTAGGTTTAATGAGTGGTTTTACTATATAGTTGAATCATATTT
rJMSF002E12+ TTTACCACCCGCTGATATTAGGTTTAATGAGTGGTTTTACTATATAGNTGAATCATATTT
rJMFF042B09+ TTTACCACCCGCTGATATTAGGTTTAATGAGTGGTTTTACTATATAGTTGAATCATATTT
                      ____________________________________________________________
consensus TTTACCACCCGCTGATATTAGGTTTAATGAGTGGTTTTACTATATAGTTGAATCATATTT
 
. : . : . : . : . : . :
rJMFF019O18+ TTCTTTCTTCAA-GCATATGTGGCTGGAGAAAGGTTGATTTGGTTGGGGTTATAAGTGTA
JMFS002A01+ TTCTTTCTTCAA-GCATATGTGGCTGGAGAAAGGTTGATTTGGTTGGGGTTATAAGTGTA
JMFS151C12+ TTCTTTCTTCAA-GCATATGTGGCTGGAGAAAGGTTGATTTGGTTGGGGTTATAAGTGTA
rJMSF002E12+ TTCTTTCTTCAANGCATATGTGGCTGGAGAAAGGTTGATTTGGTTGGGG-TATAAGTGTA
rJMFF042B09+ TTCTTTCTTCAA-GCATATGTGGCTGGAGAAAGGTTGATTTGGTTGGGGTTATAAGTGTA
                      ____________________________________________________________
consensus TTCTTTCTTCAA-GCATATGTGGCTGGAGAAAGGTTGATTTGGTTGGGGTTATAAGTGTA
 
. : . : . : . : . : . :
rJMFF019O18+ AATTTCTTATTTGATTAG
JMFS002A01+ AATTTCTTATTTGATTAG
JMFS151C12+ AATTTCTTATTTGATTAG
rJMSF002E12+ AATT
rJMFF042B09+ AATTTCTTATTTGATTAGCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus AATTTCTTATTTGATTAGCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG