Previous Contig 010191:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003J03Sequence567005428 (4)gb:AY589088_16165434e-46Glycine max mitochondrial pyruvate dehydrogenase kinase isoform 1 gene, complete698010191 (5)gb:AJ630654_18127671e-85Cicer arietinum mRNA for pyruvate dehydrogenase kinase (Pdk gene).
JMFF007L11Sequence627005428 (4)gb:AY589088_16165437e-58Glycine max mitochondrial pyruvate dehydrogenase kinase isoform 1 gene, complete785010191 (5)gb:AJ630654_18127674e-98Cicer arietinum mRNA for pyruvate dehydrogenase kinase (Pdk gene).
JMFF042B05Sequence634005428 (4)gb:AY589088_16165431e-56Glycine max mitochondrial pyruvate dehydrogenase kinase isoform 1 gene, complete644010191 (5)gb:AJ630654_18127672e-69Cicer arietinum mRNA for pyruvate dehydrogenase kinase (Pdk gene).
JMFS027A08Sequence213010191 (5)
JMSF013M19Sequence456005428 (4)gb:AY035017_15597956e-22Arabidopsis thaliana putative pyruvate dehydrogenase kinase (At3g06483) mRNA, co741010191 (5)gb:AJ630654_18127671e-93Cicer arietinum mRNA for pyruvate dehydrogenase kinase (Pdk gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF013M19+ TTATTGGGCAGCATGTG-NCNTGCATGATC
rJMFF007L11+ GAATGCTTATTGGGCAGCATGTGNCCTTGCATGATC
                      ____________________________________________________________
consensus GAATGCTTATTGGGCAGCATGTGNCCTTGCATGATC
 
. : . : . : . : . : . :
rJMSF013M19+ CCAATCCTCTTCCTGACTGTATTGGGTATATACATACGAAAATGTCACCAGTTGAGGTTG
rJMFF003J03+ GACTGTATTGGGTATATACATACGAAAATGTCACCAGTTGAGGTTG
rJMFF007L11+ CCAATCCTCTTCCTGACTGTATTGGGTATATACATACGAAAATGTCACCAGTTGAGGTTG
                      ____________________________________________________________
consensus CCAATCCTCTTCCTGACTGTATTGGGTATATACATACGAAAATGTCACCAGTTGAGGTTG
 
. : . : . : . : . : . :
rJMSF013M19+ CACGAAATGCCAGTGAAGATGCTCGTTGTGTTTGTTTCCGAGAGTATGGCAGTGCACCTG
rJMFF003J03+ CACGAAATGCCAGTGAAGATGCTCGTTGTGTTTGTTTCCGAGAGTATGGCAGTGCACCTG
rJMFF007L11+ CACGAAATGCCAGTGAAGATGCTCGTTGTGTTTGTTTCCGAGAGTATGGCAGTGCACCTG
                      ____________________________________________________________
consensus CACGAAATGCCAGTGAAGATGCTCGTTGTGTTTGTTTCCGAGAGTATGGCAGTGCACCTG
 
. : . : . : . : . : . :
rJMSF013M19+ AAGTTAGCATTTATGGAGATCCCAATTTCACTTTCCCGTATGTGCCAACACATCTACAAT
rJMFF003J03+ AAGTTAGCATTTATGGAGATCCCAATTTCACTTTCCCGTATGTGCCAACACATCTACAAT
rJMFF007L11+ AAGTTAGCATTTATGGAGATCCCAATTTCACTTTCCCGTATGTGCCAACACATCTACAAT
rJMFF042B05+ AGATCCCAATTTCACTTTCCCGTATGTGCCAACACATCTACAAT
                      ____________________________________________________________
consensus AAGTTAGCATTTATGGAGATCCCAATTTCACTTTCCCGTATGTGCCAACACATCTACAAT
 
. : . : . : . : . : . :
rJMSF013M19+ TGATGGTGTTTGAATTGGTTAAGAACTCCTTGCGTGCTGTTCAAGAGCGATACATGGATT
rJMFF003J03+ TGATGGTGTTTGAATTGGTTAAGAACTCCTTGCGTGCTGTTCAAGAGCGATACATGGATT
rJMFF007L11+ TGATGGTGTTTGAATTGGTTAAGAACTCCTTGCGTGCTGTTCAAGAGCGATACATGGATT
rJMFF042B05+ TGATGGTGTTTGAATTGGTTAAGAACTCCTTGCGTGCTGTTCAAGAGCGATACATGGATT
                      ____________________________________________________________
consensus TGATGGTGTTTGAATTGGTTAAGAACTCCTTGCGTGCTGTTCAAGAGCGATACATGGATT
 
. : . : . : . : . : . :
rJMSF013M19+ CGGACAAGGTTGCACCTCCTGTTCGCTTAATAGTAGCTGATGGTTTGGAAGATGTTACGA
rJMFF003J03+ CGGACAAGGTTGCACCTCCTGTTCGCTTAATAGTAGCTGATGGTTTGGAAGATGTTACGA
rJMFF007L11+ CGGACAAGGTTGCACCTCCTGTTCGCTTAATAGTAGCTGATGGTTTGGAAGATGTTACGA
rJMFF042B05+ CGGACAAGGTTGCACCTCCTGTTCGCTTAATAGTAGCTGATGGTTTGGAAGATGTTACGA
                      ____________________________________________________________
consensus CGGACAAGGTTGCACCTCCTGTTCGCTTAATAGTAGCTGATGGTTTGGAAGATGTTACGA
 
. : . : . : . : . : . :
rJMSF013M19+ TTAAGGTTTCTGATGAAGGTGGTGGAATACCAAGAAGTGGCCTTCCTAAAATCTTTACGT
rJMFF003J03+ TTAAGGTTTCTGATGAAGGTGGTGGAATACCAAGAAGTGGCCTTCC-AAAATCTTTACGT
rJMFF007L11+ TTAAGGTTTCTGATGAAGGTGGTGGAATACCAAGAAGTGGCCTTCCTAAAATCTTTACGT
rJMFF042B05+ TTAAGGTTTCTGATGAAGGTGGTGGAATACCAAGAAGTGGCCTTCCTAAAATCTTTACGT
                      ____________________________________________________________
consensus TTAAGGTTTCTGATGAAGGTGGTGGAATACCAAGAAGTGGCCTTCCTAAAATCTTTACGT
 
. : . : . : . : . : . :
rJMSF013M19+ ATCTCTACAGCACTGCAAGAAACCCATTGGATGAGCTATCAGACCTCGGTGCTACTGAGC
JMFS027A08- TCTACAGCACTGCAAGAAACCCATTGGATGAGCTATCAGACCTCGGTGCTACTGAGC
rJMFF003J03+ ATCTCTACAGCACTGCAAGAAACCCATTGGATGAGCTATCAGACCTCGGTGCTACTGAGC
rJMFF007L11+ ATCTCTACAGCACTGCAAGAAACCCATTGGATGAGCTATCAGACCTCGGTGCTACTGAGC
rJMFF042B05+ ATCTCTACAGCACTGCAAGAAACCCATTGGATGAGCTATCAGACCTCGGTGCTACTGAGC
                      ____________________________________________________________
consensus ATCTCTACAGCACTGCAAGAAACCCATTGGATGAGCTATCAGACCTCGGTGCTACTGAGC
 
. : . : . : . : . : . :
rJMSF013M19+ TGGCAACTGTGTCCCCGTTGGCTGGTTATGGGTATGGGCTGCCAATAAGTCGCTTGTATG
JMFS027A08- TGGCAACTGTGTCCC
rJMFF003J03+ TGGCAACTGTGTCCCCGTTGGCTGGTTATGGGTATGGGCTGCCAATAAGTCGCTTGTATG
rJMFF007L11+ TGGCAACTGTGTCCCCGTTGGCTGGTTATGGGTATGGGCTGCCAATAAGTCGCTTGTATG
rJMFF042B05+ TGGCAACTGTGTCCCCGTTGGCTGGTTATGGGTATGGGCTGCCAATAAGTCGCTTGTATG
                      ____________________________________________________________
consensus TGGCAACTGTGTCCCCGTTGGCTGGTTATGGGTATGGGCTGCCAATAAGTCGCTTGTATG
 
. : . : . : . : . : . :
rJMSF013M19+ CTCGCTACTTTGGGGGAGACCTGCAAATTATCTCCATGGAAGGATATGGGACAGATGCTT
rJMFF003J03+ CTCGCTACTTTGGGGGAGACCTGCAAATTATCTCCATGGAAGGATATGGGACAGATGCTT
rJMFF007L11+ CTCGCTACTTTGGGGGAGACCTGCAAATTATCTCCATGGAAGGATATGGGACAGATGCTT
rJMFF042B05+ CTCGCTACTTTGGGGGAGACCTGCAAATTATCTCCATGGAAGGATATGGGACAGATGCTT
                      ____________________________________________________________
consensus CTCGCTACTTTGGGGGAGACCTGCAAATTATCTCCATGGAAGGATATGGGACAGATGCTT
 
. : . : . : . : . : . :
rJMSF013M19+ ATCTTCACTTGTCAAGGCTTTGTGATTCACAGGAGCCATTGCCTTAAGAGTACTACTGCT
rJMFF003J03+ ATCTTCACTTGTCAAGGCTTTGTGATTCACAGGAGCCATTGCCTTAAGAGTACTACTGCT
rJMFF007L11+ ATCTTCACTTGTCAAGGCTTTGTGATTCACAGGAGCCATTGCCTTAAGAGTACTACTGCT
rJMFF042B05+ ATCTTCACTTGTCAAGGCTTTGTGATTCACAGGAGCCATTGCCTTAAGAGTACTACTGCT
                      ____________________________________________________________
consensus ATCTTCACTTGTCAAGGCTTTGTGATTCACAGGAGCCATTGCCTTAAGAGTACTACTGCT
 
. : . : . : . : . : . :
rJMSF013M19+ GACACTGGGATTTTTAGCATAATTTAAGTGCTGTAAATATGTTATTTAAGACACCAAGTT
rJMFF003J03+ GACACTGGGATTTTTAGCATAATTTAAGTGCTGTAAATATGTTATTTAAGACACCAAGTT
rJMFF007L11+ GACACTGGGATTTTTAGCATAATTTAAGTGCTGTAAATATGTTATTTAAGACACCAAGTT
rJMFF042B05+ GACACTGGGATTTTTAGCATAATTTAAGTGCTGTAAATATGTTATTTAAGACACCAAGTT
                      ____________________________________________________________
consensus GACACTGGGATTTTTAGCATAATTTAAGTGCTGTAAATATGTTATTTAAGACACCAAGTT
 
. : . : . : . : . : . :
rJMSF013M19+ GCAACCCCTTGTTCACATGGGAAACTCAAATGTTGTAATTGTCAATTTCTCA
rJMFF003J03+ GCAACCCCTTGTTCACATGGGAAACTCAAATGTTGTAATTGTCAATTTCTCAT
rJMFF007L11+ GCAACCCCTTGTTCACATGGGAAACTCAAATGTTGTAATTGTCAATTTCTCATTGTTGTA
rJMFF042B05+ GCAACCCCTTGTTCACATGGGAAACTCAAATGTTGTAATTGTCAATTTCTCATTGTTGTA
                      ____________________________________________________________
consensus GCAACCCCTTGTTCACATGGGAAACTCAAATGTTGTAATTGTCAATTTCTCATTGTTGTA
 
. : . : . : . : . : . :
rJMFF007L11+ TGAATTGTTGCTTATATCCA
rJMFF042B05+ TGAATTGTTGCTTATATCCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TGAATTGTTGCTTATATCCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG