Previous Contig 010181:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041P09Sequence659001787 (5)gb:BT015052_16420222e-09Arabidopsis thaliana At5g01450 gene, complete cds.>gb:BT015858_1642476 Arabidops614010181 (5)gb:BT015052_16420222e-22Arabidopsis thaliana At5g01450 gene, complete cds.>gb:BT015858_1642476 Arabidops
JMFF048L15Sequence398001787 (5)338010181 (5)
JMSF001N05Sequence419001787 (5)gb:BT015052_16420221e-04Arabidopsis thaliana At5g01450 gene, complete cds.>gb:BT015858_1642476 Arabidops677010181 (5)pir|T01251|T012511e-26hypothetical protein At2g38190 [imported] - Arabidopsis thaliana>gb:AC003028_153
JMSF019E11Sequence506001787 (5)gb:BT015052_16420224e-07Arabidopsis thaliana At5g01450 gene, complete cds.>gb:BT015858_1642476 Arabidops774010181 (5)pir|T01251|T012512e-26hypothetical protein At2g38190 [imported] - Arabidopsis thaliana>gb:AC003028_153
JMSF035L16Sequence654001787 (5)gb:BT015052_16420228e-17Arabidopsis thaliana At5g01450 gene, complete cds.>gb:BT015858_1642476 Arabidops310010181 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF019E11+ CACATACTTT
                      ____________________________________________________________
consensus CACATACTTT
 
. : . : . : . : . : . :
rJMSF001N05+ TTGTGTTCCTGGCCCAGCGTATCCTAAATAATCTG
rJMSF019E11+ CTTGGCATAGGNGGAACGTGTTTTTTTGTGTTCCTGGCCCAGCGTATCCTAAATAATNTG
                      ____________________________________________________________
consensus CTTGGCATAGGNGGAACGTGTTTTTTTGTGTTCCTGGCCCAGCGTATCCTAAATAATCTG
 
. : . : . : . : . : . :
rJMSF001N05+ CATCGTAGAGCACAATTAGAAGATACTGGATCTGAACGGGTCCCTATGCTTTCGGACAAA
rJMSF019E11+ CATCGTAGAGCACAATTAGAAGATACTGGATCTGAACGGGTCCCTATGCTTTCGGACAAA
                      ____________________________________________________________
consensus CATCGTAGAGCACAATTAGAAGATACTGGATCTGAACGGGTCCCTATGCTTTCGGACAAA
 
. : . : . : . : . : . :
rJMSF001N05+ CAAGATGACAACTTGAGTTTGGGTTCTTCTTACTGTTCTCTTTCTCAAGATGATGAGGAT
rJMSF019E11+ CAAGATGACAACTTGAGTTTGGGTTCTTCTTACTGTTCTCTTTCTCAAGATGATGAGGAT
rJMFF041P09+ TTCTCAAGATGATGAGGAT
                      ____________________________________________________________
consensus CAAGATGACAACTTGAGTTTGGGTTCTTCTTACTGTTCTCTTTCTCAAGATGATGAGGAT
 
. : . : . : . : . : . :
rJMSF001N05+ GCTGAAGAGCCAACAAGCAGCAGTACGCTTGATGGGAAGCCAGTAAAAGACAGTGAGCAG
rJMSF019E11+ GCTGAAGAGCCAACAAGCAGCAGTACGCTTGATGGGAAGCCNGTAAAAGACAGTGAGCAG
rJMFF041P09+ GCTGAAGAGCCAACAAGCAGCAGTACGCTTGATGGGAAGCCAGTAAAAGACAGTGAGCAG
                      ____________________________________________________________
consensus GCTGAAGAGCCAACAAGCAGCAGTACGCTTGATGGGAAGCCAGTAAAAGACAGTGAGCAG
 
. : . : . : . : . : . :
rJMSF001N05+ AGCGATATGCGTCATCTCTGTGCAATTTGCTTTGATGCACCAAGGGACTGTTTNTTCCTC
rJMSF019E11+ AGCGATATGCGTCATCTCTGTGCAATTTGCTTTGATGCACCAAGGGACTGTTTNTTCCTC
rJMFF041P09+ AGCGATATGCGTCATCTCTGTGCAATTTGCTTTGATGCACCAAGGGACTGTTTCTTCCTC
                      ____________________________________________________________
consensus AGCGATATGCGTCATCTCTGTGCAATTTGCTTTGATGCACCAAGGGACTGTTTCTTCCTC
 
. : . : . : . : . : . :
rJMSF001N05+ CCATGCGGACACTGCTTGTCCTGTTTTGAATGCGGAACCAAGATAGCAGAGACGGCTGGT
rJMSF019E11+ CCATGCGGACACTGCTTGTCCTGTTTTGAATGCGGAACCAAGATAGCAGAGACGGCTGGT
rJMSF035L16+ CTGCTTGTCCNGTTTTGAATGNGGAACCNAGATAGCNGAGACGGNTGGT
rJMFF041P09+ CCATGCGGACACTGCTTGTCCTGTTTTGAATGCGGAACCAAGATAGCAGAGACGGCTGGT
                      ____________________________________________________________
consensus CCATGCGGACACTGCTTGTCCTGTTTTGAATGCGGAACCAAGATAGCAGAGACGGCTGGT
 
. : . : . : . : . : . :
rJMSF001N05+ ACTTGCCCTGTATGTCGCAGGCGCATGAAGAAGGTGAAGAAGATATATACTGTTTGAACA
rJMSF019E11+ ACTTGCCCTGTATGTCGCAGGCGCATGAAGAAGGTGAAGAAGATATATACTGTTTGAACA
rJMFF048L15+ AAGGTGAAGAAGATATATACTGTTTGAACA
rJMSF035L16+ ACTTGCCCTGTANGTNGCNGGNGCNTGAAGAAGGTGAAGAAGATATNTACTGTTTGAACA
rJMFF041P09+ ACTTGCCCTGTATGTCGCAGGCGCATGAAGAAGGTGAAGAAGATATATACTGTTTGAACA
                      ____________________________________________________________
consensus ACTTGCCCTGTATGTCGCAGGCGCATGAAGAAGGTGAAGAAGATATATACTGTTTGAACA
 
. : . : . : . : . : . :
rJMSF001N05+ TCCCTTATGGACTTGCCACCTCTGTCGCCAATNTGCTGNGTATATACTGTTTGTATCATT
rJMSF019E11+ TCCCTTATGGACTTGCCACCTCTGTCGCCAATNTGCTGNGTATATACTGTTTGTATCATT
rJMFF048L15+ TCCCTTATGGACTTGCCACCTCTGTCGCCAATCTGCGGGGTATATACCGTTTGTATCATT
rJMSF035L16+ TCCCTTATGGACTTGCCNCCTNTGTCGCCAATTTGCTGGGTATATACNGTTTGTATCNTT
rJMFF041P09+ TCCCTTATGGACTTGCCACCTCTGTCGCCAATCTGCTGTGTATATACTGTTTGTATCATT
                      ____________________________________________________________
consensus TCCCTTATGGACTTGCCACCTCTGTCGCCAATCTGCTGGGTATATACTGTTTGTATCATT
 
. : . : . : . : . : . :
rJMSF001N05+ GTATTCTTGTCAATGTGATAGGCAGGCCCTNTGCCCTTTCCGCCCACCGGTAGCCTTTTN
rJMSF019E11+ GTATTCTTGTCAATGTGATAGGCAGGCCCTNTGCCCTTTCCGCCCACCGGTAGCCTTTTN
rJMFF048L15+ GTATTCTTGTCAATGTGATAGGCAGGCCCTCTGCCCTTTCCGCCCACCGGTAGCCTTTTC
rJMSF035L16+ GTATTNTTGTCAANGNGATAGGCNGGCCCTTTGCCCTTTNCGCCCNCCGGTAGCCTTTTT
rJMFF041P09+ GTATTCTTGTCAATGTGATAGGCAGGCCCTCTGCCCTTTCCGCCCACCGGTAGCCTTTTC
                      ____________________________________________________________
consensus GTATTCTTGTCAATGTGATAGGCAGGCCCTCTGCCCTTTCCGCCCACCGGTAGCCTTTTC
 
. : . : . : . : . : . :
rJMSF001N05+ TTATAAGGGAAACACGTATTTTTTCTGTGACTGACTTGAATATTTGA-AGCTGCGCCC-A
rJMSF019E11+ TTATAAGGGAAACACGTATTTTTTCTGNGACTGACTTGAATATTTGA-AGCTGCGCCC-A
rJMFF048L15+ TTATAAGGGAAACACGTATTTTTTCTGTGACTGACTTGAATATCTGATAGCTGCGCCCTA
rJMSF035L16+ TTNTAAGGGAAACNCGTATTTTTTNTGNGACTGACTTGAATATTTGA-AGNTGCGCCC-A
rJMFF041P09+ TTATAAGGGAAACACGTATTTTTTCTGTGACTGACTTGAATATTTGA-AGCTGCGCCC-A
                      ____________________________________________________________
consensus TTATAAGGGAAACACGTATTTTTTCTGTGACTGACTTGAATATTTGA-AGCTGCGCCC-A
 
. : . : . : . : . : . :
rJMSF001N05+ ACGTCG-GACGACTTTGTACTTCTCAGTGATAGTGAGGTGGTTCAAAGATANCCAGGTTG
rJMSF019E11+ ACGTCG-GACGACTTTGTACTTNTCAGTGATAGTGAGGNGGTTCAAAGATA-CCAGGTTG
rJMFF048L15+ ACGTCGCTACGACTTTGTACCTCGTAGTGATAGTGAGGTGGTTCAAAGATA-CCAGGTTG
rJMSF035L16+ ACGTCG-GNCGACTTTGTACTT
rJMFF041P09+ ACGTCG-GACGACTTTGTACTTCTCAGTGATAGTGAGGTGGTTCAAAGATA-CCAGGTTG
                      ____________________________________________________________
consensus ACGTCG-GACGACTTTGTACTTCTCAGTGATAGTGAGGTGGTTCAAAGATA-CCAGGTTG
 
. : . : . : . : . : . :
rJMSF001N05+ GTGATGATAGTTAAACCGATGTATATTGAACTTGTAAAACC
rJMSF019E11+ GNGATGATAGTTAAA-CGATGTATATTGAACTTGTAAAACC-CCTAGTA-TTTTTTTTTT
rJMFF048L15+ GTGATGACTCTTCTA-CGATGTATATTGAACTTGTAAAACC
rJMFF041P09+ GTGATGATAGTTAAA-CGATGTATATTGAACTTGTAAAACCNCCTAGTATTTTTTTTTTT
                      ____________________________________________________________
consensus GTGATGATAGTTAAA-CGATGTATATTGAACTTGTAAAACCNCCTAGTATTTTTTTTTTT
 
. : . : . : . : . : . :
rJMSF019E11+ TAATGTTATCCTGCAACGTTTATTTGTCTTCCCTCTAGTACACTCAAATCT
rJMFF041P09+ TAATGTTATCCTGCAACGTTTATTTGTCTTCCCTCTAGTACACTCAAATCTTAGTGGTCG
                      ____________________________________________________________
consensus TAATGTTATCCTGCAACGTTTATTTGTCTTCCCTCTAGTACACTCAAATCTTAGTGGTCG