Previous Contig 010168:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041N05Sequence660010168 (4)gb:AC142505_17440952e-54Solanum demissum chromosome 5 BAC PGEC287I17 genomic sequence, complete sequence598010168 (4)pir|T12634|T126342e-09homeotic protein - common sunflower>gb:HNNH1P_1681952 Helianthus annuus homeodom
JMSF018H17Sequence463010168 (4)gb:AC145120_17442715e-05Solanum demissum chromosome 5 BAC PGEC446O19 genomic sequence, complete sequence782010168 (4)gb:AC142505_17440952e-54Solanum demissum chromosome 5 BAC PGEC287I17 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF018H17- GAAGTTGAATCCACAAACCATCCCCTTGCAGAATTCACACCGTTATAAT
                      ____________________________________________________________
consensus GAAGTTGAATCCACAAACCATCCCCTTGCAGAATTCACACCGTTATAAT
 
. : . : . : . : . : . :
JMSF018H17- TATTATTATTATTTTCTCTTTCTTGAACCCACACGAATATTCTTGAAAATAACTACTGTT
                      ____________________________________________________________
consensus TATTATTATTATTTTCTCTTTCTTGAACCCACACGAATATTCTTGAAAATAACTACTGTT
 
. : . : . : . : . : . :
JMSF018H17- CTCCGATCCAATTTTTCGTCCATAAAAATTAGAATATATAAATATATATTTCGACTGTAG
                      ____________________________________________________________
consensus CTCCGATCCAATTTTTCGTCCATAAAAATTAGAATATATAAATATATATTTCGACTGTAG
 
. : . : . : . : . : . :
JMSF018H17- TGTACTACTCATATATAGATCTGATCTGATCTGATCTTCTTCTTCTTCTTCTTCTTCATA
                      ____________________________________________________________
consensus TGTACTACTCATATATAGATCTGATCTGATCTGATCTTCTTCTTCTTCTTCTTCTTCATA
 
. : . : . : . : . : . :
JMSF018H17- TGTTGTAATTAAGTATGAACAAAAGGCAGGCAGCAAGAATCCAAAAGCTAAGCTAGTGTA
JMFF041N05- TGTAATTAAGTATGAACAAAAGGCAGGCAGCAAGAATCCAAAAGCTAAGCTAGTGTA
                      ____________________________________________________________
consensus TGTTGTAATTAAGTATGAACAAAAGGCAGGCAGCAAGAATCCAAAAGCTAAGCTAGTGTA
 
. : . : . : . : . : . :
JMSF018H17- TTAGGTCAGGTCATGACTTCTTGCATCGGAATGGATTTCTTCCCCACCAATTTTATGCTT
JMFF041N05- TTAGGTCAGGTCATGACTTCTTGCATCGGAATGGATTTCTTCCCCACCAATTTTATGCTT
                      ____________________________________________________________
consensus TTAGGTCAGGTCATGACTTCTTGCATCGGAATGGATTTCTTCCCCACCAATTTTATGCTT
 
. : . : . : . : . : . :
JMSF018H17- CAAACCCCTCATCATGATCCCAATGATCATCATCATCATCAACCCTCCACCGCTCTCTCT
JMFF041N05- CAAACCCCTCATCATGATCCCAATGATCATCATCATCATCAACCCTCCACCGCTCTCTCT
                      ____________________________________________________________
consensus CAAACCCCTCATCATGATCCCAATGATCATCATCATCATCAACCCTCCACCGCTCTCTCT
 
. : . : . : . : . : . :
JMSF018H17- CCCCTCTTTCCTTCATGCACTATTCCTCCTCCTCCTCAGAACTTCCATGGAGTA
JMFF041N05- CCCCTCTTTCCTTCATGCACTATTCCTCCTCCTCCTCAGAACTTCCATGGAGTAGTGGGT
                      ____________________________________________________________
consensus CCCCTCTTTCCTTCATGCACTATTCCTCCTCCTCCTCAGAACTTCCATGGAGTAGTGGGT
 
. : . : . : . : . : . :
JMFF041N05- GGGAGTTCATTTCTTGGTGGGAAGAGATCAATGAAGTGTTGTGAAGAGGCATTGTCACAT
                      ____________________________________________________________
consensus GGGAGTTCATTTCTTGGTGGGAAGAGATCAATGAAGTGTTGTGAAGAGGCATTGTCACAT
 
. : . : . : . : . : . :
JMFF041N05- GGAGATGTGCAGGAAGAGGTGTCAGATGAGGAAGAAGGGTCAGTGCAGGCAGGAGAGAAC
                      ____________________________________________________________
consensus GGAGATGTGCAGGAAGAGGTGTCAGATGAGGAAGAAGGGTCAGTGCAGGCAGGAGAGAAC
 
. : . : . : . : . : . :
JMFF041N05- AACAAGAAAAGGAGACTGAACACGGAACAAGTGAAGGCTCTGGAGAAGAGCTTCGAGGTG
                      ____________________________________________________________
consensus AACAAGAAAAGGAGACTGAACACGGAACAAGTGAAGGCTCTGGAGAAGAGCTTCGAGGTG
 
. : . : . : . : . : . :
JMFF041N05- GGAAACAAGCTGGAACCAGAGAGGAAAATGCAGCTGGCTAGAGCTCTGGGTTTGCAGCCA
rJMSF018H17+ CCAGAGAGGAAAATGCAGCTGGCTAGAGCTCTGGGTTTGCAGCCA
                      ____________________________________________________________
consensus GGAAACAAGCTGGAACCAGAGAGGAAAATGCAGCTGGCTAGAGCTCTGGGTTTGCAGCCA
 
. : . : . : . : . : . :
JMFF041N05- AGACAGATCGCGATTTGGTTCCAGAACAGGCGAGCTCGGTGGAAGACTAAGCAGCTGGAA
rJMSF018H17+ AGACAGATCGCGATTTGGTTCCAGAACAGGCGAGCTCGGTGGAAGACTAAGCAGCTGGAA
                      ____________________________________________________________
consensus AGACAGATCGCGATTTGGTTCCAGAACAGGCGAGCTCGGTGGAAGACTAAGCAGCTGGAA
 
. : . : . : . : . : . :
JMFF041N05- AGGGACTATGAATCCCTCAAGAGACAGTTCGACGCTGTCAAGGCTGAAAATGATGCTCTT
rJMSF018H17+ AGGGACTATGAATCCCTCAAGAGACAGTTCGACGCTGTCAAGGCTGAAAATGATGCTCTT
                      ____________________________________________________________
consensus AGGGACTATGAATCCCTCAAGAGACAGTTCGACGCTGTCAAGGCTGAAAATGATGCTCTT
 
. : . : . : . : . : . :
JMFF041N05- CTTGCTCATAATCAAAAGCTTCATGCCCAGGTAAT
rJMSF018H17+ CTTGCTCATAATCAAAAGCTTCATGCCCAGATAATGGGAGTGAAGAATAGTAGGTGTAGG
                      ____________________________________________________________
consensus CTTGCTCATAATCAAAAGCTTCATGCCCAGGTAATGGGAGTGAAGAATAGTAGGTGTAGG
 
. : . : . : . : . : . :
rJMSF018H17+ GATAGCATTCAACCCACAGAATCCATAAATCTGAACAAAGAGACAGAAGGTTCATGCAGT
                      ____________________________________________________________
consensus GATAGCATTCAACCCACAGAATCCATAAATCTGAACAAAGAGACAGAAGGTTCATGCAGT
 
. : . : . : . : . : . :
rJMSF018H17+ AACAGTAGAAGTGAGAACAGTTGTGCAGAAATAATGAAGCTAGACATTATCTCAAGGAGC
rJMFF041N05+ CAGTAGAAGTGAGAACAGTTGTGCGGAAATAATGAAGCTAGACATTATCTCAAGGAGC
                      ____________________________________________________________
consensus AACAGTAGAAGTGAGAACAGTTGTGCGGAAATAATGAAGCTAGACATTATCTCAAGGAGC
 
. : . : . : . : . : . :
rJMSF018H17+ ACAGCTGCCATTGATAGCCATCCAACAACTACTACTACTACTACAACATCATCTCTGTTC
rJMFF041N05+ ACAGCTGCCATTGATAGCCATCCAACAACTACTACTACTACTACAACATCATCTCTGTTC
                      ____________________________________________________________
consensus ACAGCTGCCATTGATAGCCATCCAACAACTACTACTACTACTACAACATCATCTCTGTTC
 
. : . : . : . : . : . :
rJMSF018H17+ CCAGCTGCAGGGATATCAATGCCCCATCTCTTTCACAATAATAATTCTTCATCATCGTCA
rJMFF041N05+ CCAGCTGCAGGGATATCAATGCCCCATCTCTTTCACAATAATAATTCTTCATCATCGTCA
                      ____________________________________________________________
consensus CCAGCTGCAGGGATATCAATGCCCCATCTCTTTCACAATAATAATTCTTCATCATCGTCA
 
. : . : . : . : . : . :
rJMSF018H17+ AGACACTCGGATCTTATCCATCATTGCCTCAAAATGGACCCAACTGTGAAGGAAGAGAGC
rJMFF041N05+ AGACACTCGGATCTTATCCATCATTGCCTCAAAATGGACCCAACTGTGAAGGAAGAGAGC
                      ____________________________________________________________
consensus AGACACTCGGATCTTATCCATCATTGCCTCAAAATGGACCCAACTGTGAAGGAAGAGAGC
 
. : . : . : . : . : . :
rJMSF018H17+ CTATCCAACATGTTCTGTGGGGGAGATGATCACTCTGGATTCTGGCCCTGGTTGGATCAA
rJMFF041N05+ CTATCCAACATGTTCTGTGGGGGAGATGATCACTCTGGATTCTGGCCCTGGTTGGATCAA
                      ____________________________________________________________
consensus CTATCCAACATGTTCTGTGGGGGAGATGATCACTCTGGATTCTGGCCCTGGTTGGATCAA
 
. : . : . : . : . : . :
rJMSF018H17+ CACCATTTCAATTGATCTTCATTTCTGTATGTGGATCATATCATATCATATCCACTACGT
rJMFF041N05+ CACCATTTCAATTGATCTTCATTTCTGTATGTGGATCATATCATATCATATCCACTACGT
                      ____________________________________________________________
consensus CACCATTTCAATTGATCTTCATTTCTGTATGTGGATCATATCATATCATATCCACTACGT
 
. : . : . : . : . : . :
rJMSF018H17+ ACTTATGTTACGTTGTGATCAGATATATTTTACTACATATATATAAAAGATTTATTTGGG
rJMFF041N05+ ACTTATGTTACGTTGTGATCAGATATATTTTACTACATATATATAAAAGATTTATTTGGG
                      ____________________________________________________________
consensus ACTTATGTTACGTTGTGATCAGATATATTTTACTACATATATATAAAAGATTTATTTGGG
 
. : . : . : . : . : . :
rJMSF018H17+ GTTTGAGGTTCTTTCTTTTAATTTGGTTGGTGCCTATCCTAGCTAGCTAGGAAGGAAGCT
rJMFF041N05+ GTTTGAGGTTCTTTCTTTTAATTTGGTTGGTGCCTATCCTAGCTAGCTAGGAAGGAAGCT
                      ____________________________________________________________
consensus GTTTGAGGTTCTTTCTTTTAATTTGGTTGGTGCCTATCCTAGCTAGCTAGGAAGGAAGCT
 
. : . : . : . : . : . :
rJMSF018H17+ TAGTTGATTAATTTCTG
rJMFF041N05+ TAGTTGATTGATTTCTGTATAAACTTAAGTTAGTAGCAAGAACCACTATATACTTTGTTT
                      ____________________________________________________________
consensus TAGTTGATTGATTTCTGTATAAACTTAAGTTAGTAGCAAGAACCACTATATACTTTGTTT
 
. : . : . : . : . : . :
rJMFF041N05+ TTCTTTTTTTTCTTTTTTTGTGAAGTTATGAAATTTTACGATCAATATATATGCTTAATT
                      ____________________________________________________________
consensus TTCTTTTTTTTCTTTTTTTGTGAAGTTATGAAATTTTACGATCAATATATATGCTTAATT