Previous Contig 010164:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004K18Sequence499000218 (4)754010164 (4)gb:AB010070_15108711e-12Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK20.
JMFF015C19Sequence516000218 (4)665010164 (4)gb:AY350713_16016571e-05Capsella rubella clone BAC Cr33L6, complete sequence.
JMFF016I02Sequence464000218 (4)756010164 (4)gb:AB010070_15108711e-12Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK20.
JMFF041M12Sequence594000218 (4)gb:AY350710_21450406e-11Brassica oleracea clone BAC Bo37N21, partial sequence.593010164 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF016I02+ GCTAAAGACGACATTTTTTTGCCGAATGTGGTCAAGAATGCCATCATTGAGGA
rJMFF004K18+ TAAAGACGACATTTTTTTGCCGAATGTGGTCAAGAATGCCATCATTGAGGA
                      ____________________________________________________________
consensus GCTAAAGACGACATTTTTTTGCCGAATGTGGTCAAGAATGCCATCATTGAGGA
 
. : . : . : . : . : . :
rJMFF016I02+ TCGGATTACAGACTTGTTTCATCCGATGGTTCTTGGCCAAAGCAATGGTAAAAAAGAGGC
rJMFF015C19+ AAAGCAATGGTAAAAAAGAGGC
rJMFF004K18+ TCGGATTACAGACTTGTTTCATCCGATGGTTCTTGGCCAAAGCAATGGTAAAAAAGAGGC
                      ____________________________________________________________
consensus TCGGATTACAGACTTGTTTCATCCGATGGTTCTTGGCCAAAGCAATGGTAAAAAAGAGGC
 
. : . : . : . : . : . :
rJMFF016I02+ GGTTGAAGATCATATTCTTGAATTGCTTCGACTTGCAATGGATTGCTGTTCCCCGTCGCC
rJMFF015C19+ GGTTGAAGATCATATTCTTGAATTGCTTCGACTTGCAATGGATTGCTGTTCCCCGTCGCC
rJMFF004K18+ GGTTGAAGATCATATTCTTGAATTGCTTCGACTTGCAATGGATTGCTGTTCCCCGTCGCC
                      ____________________________________________________________
consensus GGTTGAAGATCATATTCTTGAATTGCTTCGACTTGCAATGGATTGCTGTTCCCCGTCGCC
 
. : . : . : . : . : . :
rJMFF016I02+ TTCTCTTCGGCCTACCGTTAAGGAGTTCCTCACTAGACTCGAAGAAATTGAAAGGTAACA
rJMFF015C19+ TTCTCTTCGGCCTACCGTTAAGGAGTTCCTCACTAGACTCGAAGAAATTGAAAGGTAACA
rJMFF004K18+ TTCTCTTCGGCCTACCGTTAAGGAGTTCCTCACTAGACTCGAAGAAATTGAAAGGTAACA
rJMFF041M12+ CGGCCTACCGTTAAGGAGTTCCTCACTAGACTCGAAGAAATTGAAAGGTAACA
                      ____________________________________________________________
consensus TTCTCTTCGGCCTACCGTTAAGGAGTTCCTCACTAGACTCGAAGAAATTGAAAGGTAACA
 
. : . : . : . : . : . :
rJMFF016I02+ ATAAACGATAATTTTCTGCTGAAATGTGAACCCAGTTTTCTCGACAATCACTCGATCAAC
rJMFF015C19+ ATAAACGATAATTTTCTGCTGAAATGTGAACCCAGTTTTCTCGACAATCACTCGATCAAC
rJMFF004K18+ ATAAACGATAATTTTCTGCTGAAATGTGAACCCAGTTTTCTCGACAATCACTCGATCAAC
rJMFF041M12+ ATAAACGATAATTTTCTGCTGAAATGTGAACCCAGTTTTCTCGACAATCACTCGATCAAC
                      ____________________________________________________________
consensus ATAAACGATAATTTTCTGCTGAAATGTGAACCCAGTTTTCTCGACAATCACTCGATCAAC
 
. : . : . : . : . : . :
rJMFF016I02+ TTGTGACACACATTGAGGCAGCCTAGTACAGCAATGACGATGTTGATTAATCTAACATTT
rJMFF015C19+ TTGTGACACACATTGAGGCAGCCTAGTACAGCAATGACGATGTTGATTAATCTAACATTT
rJMFF004K18+ TTGTGACACACATTGAGGCAGCCTAGTACAGCAATGACGATGTTGATTAATCTAACATTT
rJMFF041M12+ TTGTGACACACATTGAGGCAGCCTAGTACAGCAATGACGATGTTGATTAATCTAACATTT
                      ____________________________________________________________
consensus TTGTGACACACATTGAGGCAGCCTAGTACAGCAATGACGATGTTGATTAATCTAACATTT
 
. : . : . : . : . : . :
rJMFF016I02+ GGGGTATACCGTGCTTTGGGGAATCAATCTTGAAACGCCACATTTCACATTTCAATCTGT
rJMFF015C19+ GGGGTATACCGTGCTTTGGGGAATCAATCTTGAAACGCCACATTTCACATTTCAATCTGT
rJMFF004K18+ GGGGTATACCGTGCTTTGGGGAATCAATCTTGAAACGCCACATTTCACATTTCAATCTGT
rJMFF041M12+ GGGGTATACCGTGCTTTGGGGAATCAATCTTGAAACGCCACATTTCACATTTCAATCTGT
                      ____________________________________________________________
consensus GGGGTATACCGTGCTTTGGGGAATCAATCTTGAAACGCCACATTTCACATTTCAATCTGT
 
. : . : . : . : . : . :
rJMFF016I02+ TCAGTCACTATATTGCAAGATTGAAAGGGAAGCTACAAGAATTATGAAGCTGGCCCTTGA
rJMFF015C19+ TCAGTCACTATATTGCAAGATTGAAAGGGAAGCTACAAGAATTATGAAGCTGGCCCTTGA
rJMFF004K18+ TCAGTCACTATATTGCAAGATTGAAAGGGAAGCTACAAGAATTATGAAGCTGGCCCTTGA
rJMFF041M12+ TCAGTCACTATATTGCAAGATTGAAAGGGAAGCTACAAGAATTATGAAGCTGGCCCTTGA
                      ____________________________________________________________
consensus TCAGTCACTATATTGCAAGATTGAAAGGGAAGCTACAAGAATTATGAAGCTGGCCCTTGA
 
. : . : . : . : . : . :
rJMFF016I02+ TCTTTTCCTGCTCGAAATGAATACCAGATTTCTTTATCATAGGGAGTTTGCTTGCTTGCA
rJMFF015C19+ TCTTTTCCTGCTCGAAATGAATACCAGATTTCTTTATCATAGGGAGTTTGCTTGCTTGCA
rJMFF004K18+ TCTTTTCCTGCTCGAAATGAATACCAGATTTCTTTATCATAGGGAGTTTGCTTGCTTGCA
rJMFF041M12+ TCTTTTCCTGCTCGAAATGAATACCAGATTTCTTTATCATAGGGAGTTTGCTTGCTTGCA
                      ____________________________________________________________
consensus TCTTTTCCTGCTCGAAATGAATACCAGATTTCTTTATCATAGGGAGTTTGCTTGCTTGCA
 
. : . : . : . : . : . :
rJMFF016I02+ AGAAAATTCACGGGGTTATTAGAATGGAGAGGCCGAAAGATTCTTTAGCCAAATTCTTGT
rJMFF015C19+ AGAAAATTCACGGGGTTATTAGAATGGAGAGGCCGAAAGATTCTTTAGCCAAATTCTTGT
rJMFF004K18+ AGAAAATTCACGGGGTTATTAGAATGGAGAGGCCGAAAGATTCTTTAGCCAAATTCTTGT
rJMFF041M12+ AGAAAATTCACGGGGTTATTAGAATGGAGAGGCCGAAAGATTCTTTAGCCAAATTCTTGT
                      ____________________________________________________________
consensus AGAAAATTCACGGGGTTATTAGAATGGAGAGGCCGAAAGATTCTTTAGCCAAATTCTTGT
 
. : . : . : . : . : . :
rJMFF016I02+ AATCTAATGACATTCGATTTTATCAGAATATCTCAGAACTGAAGATGATGACACTCATAT
rJMFF015C19+ AATCTAATGACATTCGATTTTATCAGAATATCTCAGAACTGAAGATGATGACACTCATAT
rJMFF004K18+ AATCTAATGACATTCGATTTTATCAGAATATCTCAGAACTGAAGATGATGACACTCATAT
rJMFF041M12+ AATCTAATGACATTCGATTTTATCAGAATATCTCAGAACTGAAGATGATGACACTCATAT
                      ____________________________________________________________
consensus AATCTAATGACATTCGATTTTATCAGAATATCTCAGAACTGAAGATGATGACACTCATAT
 
. : . : . : . : . : . :
rJMFF016I02+ CTTGAATCTGCAGGCCATCCTACAGTTCAGAACTACACGGAGTTTGTCAAACTTATAAGA
rJMFF015C19+ CTTGAATCTGCAGGCCATCCTACAGTTCAGAACTACACGGAGTTTGTCAAACTTATAAGA
rJMFF004K18+ CTTGAATCTGCAGGCCATCCTACAGTTCAGAACTACACGGAGTTTGTCAAACTTATAAGA
rJMFF041M12+ CTTGAATCTGCAGGCCATCCTACAGTTCAGAACTACACGGAGTTTGTCAAACTTATAAGA
                      ____________________________________________________________
consensus CTTGAATCTGCAGGCCATCCTACAGTTCAGAACTACACGGAGTTTGTCAAACTTATAAGA
 
. : . : . : . : . : . :
rJMFF016I02+ GATTAGATCTTACTGTATACATTTGATGATTATATATAAATCA
rJMFF015C19+ GATTAGATCTTACTGTATACATTTGATGATTATATATAAATCA
rJMFF004K18+ GATTAGATCTTACTGTATACATTTGATGATTATATATAAATCA
rJMFF041M12+ GATTAGATCTTACTGTATACATTTGATGATTATATATAAATCATATGCTAATTTCTTTTC
                      ____________________________________________________________
consensus GATTAGATCTTACTGTATACATTTGATGATTATATATAAATCATATGCTAATTTCTTTTC