Previous Contig 010162:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004C15Sequence554000676 (5)gb:AP003274_18269707e-76Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051740010162 (6)gb:AF419301_17984061e-96Securigera parviflora aspartate aminotransferase (CRAAT1) mRNA, partial cds.
JMFF007P24Sequence573000676 (5)gb:AP003274_18269703e-74Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051769010162 (6)gb:AF419301_17984062e-89Securigera parviflora aspartate aminotransferase (CRAAT1) mRNA, partial cds.
JMFF012N21Sequence490000676 (5)gb:AP003274_18269702e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051417010162 (6)gb:AF470319_18028503e-39Musa acuminata aspartate aminotransferase 1 mRNA, partial cds.>gb:AF470320_18028
JMFF017F14Sequence592000676 (5)sp|P28734|AATC_DAUCA2e-84Aspartate aminotransferase, cytoplasmic (EC 2.6.1.1) (Transaminase A).>pir|T1431743010162 (6)gb:AF419301_17984066e-94Securigera parviflora aspartate aminotransferase (CRAAT1) mRNA, partial cds.
JMFF026M08Sequence688010162 (6)pir|S53303|S533032e-77aspartate transaminase (EC 2.6.1.1) AAT2 - proso millet>gb:PMAAT2_1700704 P.mili
JMFF041M07Sequence644000676 (5)sp|P28734|AATC_DAUCA2e-77Aspartate aminotransferase, cytoplasmic (EC 2.6.1.1) (Transaminase A).>pir|T1431573010162 (6)pir|S53303|S533037e-54aspartate transaminase (EC 2.6.1.1) AAT2 - proso millet>gb:PMAAT2_1700704 P.mili

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF017F14+ GGGGTAGACC
                      ____________________________________________________________
consensus GGGGTAGACC
 
. : . : . : . : . : . :
rJMFF017F14+ CAACTATTGAGCAGTGGGGGAAAATCAGGGAGCTGCTACGATCCAAAGGGTTGTTACCTT
rJMFF004C15+ TATTGAGCAGTGGGGGAAAATCAGGGAGCTGATACGATCCAAAGGGTTGTTACCTT
rJMFF007P24+ GGGTTGTTACCTT
                      ____________________________________________________________
consensus CAACTATTGAGCAGTGGGGGAAAATCAGGGAGCTGCTACGATCCAAAGGGTTGTTACCTT
 
. : . : . : . : . : . :
rJMFF017F14+ TCTTTGACAGTGCTTATCAGGGTTTTGCTAGTGGCAATCTTGATGCAGATGCAAAGTCTG
rJMFF004C15+ TCTTTGACAGTGCTTATCAGGGTTTTGCTAGTGGCAATCTTGATGCAGATGCAAAGTCTG
rJMFF007P24+ TCTTTGACAGTGCTTATCAGGGTTTTGCTAGTGGCAATCTTGGTGCAGATGCAAAGTCTG
                      ____________________________________________________________
consensus TCTTTGACAGTGCTTATCAGGGTTTTGCTAGTGGCAATCTTGATGCAGATGCAAAGTCTG
 
. : . : . : . : . : . :
rJMFF017F14+ TTCGCCTTTTCGTTGCAGACGGTGGTGAATTGCTTATGGCACAGAGTTATGCAAAAAATA
rJMFF004C15+ TTCGCCTTTTCGTTGCAGACGGTGGTGAATTGCTTATGGCACAGAGTTATGCAAAAAATA
rJMFF026M08+ TTTCGTTGCAGACGGTGGTGAATTGCTTATGGCACAGAGTTATGCAAAAAATA
rJMFF007P24+ TTCGCCTTTTCGTTGCAGACGGTGGTGAATTGCTTATGGCACAGAGTTATGCAAAAAATA
                      ____________________________________________________________
consensus TTCGCCTTTTCGTTGCAGACGGTGGTGAATTGCTTATGGCACAGAGTTATGCAAAAAATA
 
. : . : . : . : . : . :
rJMFF017F14+ TGCGGACTGTATGGGGAACGTGTCGGTGCCCTTAGCATTGTTTGCAGAAATGCAGAAGTA
rJMFF004C15+ TG-GGACTGTATGGGGAACGTGTCGGTGCCCTTAGCATTGTTTGCAGAAATGCAGAAGTA
rJMFF026M08+ TG-GGACTGTATGGGGAACGTGTCGGTGCCCTTAGCATTGTTTGCAGAAATGCAGAAGTA
rJMFF007P24+ TG-GGACTGTATGGGGAACGTGTCGGTGCCCTTAGCATTGTTTGCAGAAATGCAGAAGTA
                      ____________________________________________________________
consensus TG-GGACTGTATGGGGAACGTGTCGGTGCCCTTAGCATTGTTTGCAGAAATGCAGAAGTA
 
. : . : . : . : . : . :
rJMFF017F14+ GCCAGCAGGGTTGAAAGCCAATTGAAGCTAGTCATCAGGCCTATGTACTCAAGTCCGCCC
rJMFF004C15+ GCCAGCAGGGTTGAAAGCCAATTGAAGCTAGTCATCAGGCCTATGTACTCAAGTCCGCCC
rJMFF026M08+ GCCAGCAGGGTTGAAAGCCAATTGAAGCTAGTCATCAGGCCTATGTACTCAAGTCCGCCC
rJMFF007P24+ GCCAGCAGGGTTGAAAGCCAATTGAAGCTAGTCATCAGGCCTATGTACTCAAGTCCGCCC
rJMFF041M07+ CTAGTCATCAGGCCTATGTACTCAAGTCCGCCC
                      ____________________________________________________________
consensus GCCAGCAGGGTTGAAAGCCAATTGAAGCTAGTCATCAGGCCTATGTACTCAAGTCCGCCC
 
. : . : . : . : . : . :
rJMFF017F14+ CTTCATGGTGCATCCATCGTTGCTACCATACTCAAGGACAGGATAATGTTTGAGGAATGG
rJMFF004C15+ CTTCATGGTGCATCCATCGTTGCTACCATACTCAAGGACAGGATAATGTTTGAGGAATGG
rJMFF026M08+ CTTCATGGTGCATCCATCGTTGCTACCATACTCAAGGACAGGATAATGTTTGAGGAATGG
rJMFF012N21+ GACAGGATAATGTTTGAGGAATGG
rJMFF007P24+ CTTCATGGTGCATCCATCGTTGCTACCATACTCAAGGACAGGATAATGTTTGAGGAATGG
rJMFF041M07+ CTTCATGGTGCATCCATCGTTGCTACCATACTCAAGGACAGGATAATGTTTGAGGAATGG
                      ____________________________________________________________
consensus CTTCATGGTGCATCCATCGTTGCTACCATACTCAAGGACAGGATAATGTTTGAGGAATGG
 
. : . : . : . : . : . :
rJMFF017F14+ ACTGTTGAACTGAAAGCAATGGCTGATCGAATCATCACCATGCGAAAACAACTTTTTGAG
rJMFF004C15+ ACTGTTGAACTGAAAGCAATGGCTGATCGAATCATCAGCATGCGAAAACAACTTTTTGAG
rJMFF026M08+ ACTGTTGAACTGAAAGCAATGGCTGATCGAATCATCAGCATGCGAAAACAACTTTTTGAG
rJMFF012N21+ TCTGTTGAACTGAAAGCAATGGCTGATCGAATCATCAGCATGCGAAAACAACTTTTTGAG
rJMFF007P24+ ACTGTTGAACTGAAAGCAATGGCTGATCGAATCATCAGCATGCGAAAACAACTTTTTGAG
rJMFF041M07+ ACTGTTGAACTGAAAGCAATGGCTGATCGAATCATCAGCATGCGAAAACAACTTTTTGAG
                      ____________________________________________________________
consensus ACTGTTGAACTGAAAGCAATGGCTGATCGAATCATCAGCATGCGAAAACAACTTTTTGAG
 
. : . : . : . : . : . :
rJMFF017F14+ GCTTTACTAGCTAAAGGCACACCAGGTGACTGGAGTCATATTATCAAACAAATTGGAATG
rJMFF004C15+ GCTTTACTAGCTAAAGGCACACCAGGTGACTGGAGTCATATTATCAAACAAATTGGAATG
rJMFF026M08+ GCTTTACTAGCTAAAGGCACACCAGGTGACTGGAGTCATATTATCAAACAAATTGGAATG
rJMFF012N21+ GCTTTAATAGCTAAAGGCACACCAGGTGACTGGAGTCATATTATCAAACAAATTGGAATG
rJMFF007P24+ GCTTTACTAGCTAAAGGCACACCAGGTGACTGGAGTCATATTATCAAACAAATTGGAATG
rJMFF041M07+ GCTTTACTAGCTAAAGGCACACCAGGTGACTGGAGTCATATTATCAAACAAATTGGAATG
                      ____________________________________________________________
consensus GCTTTACTAGCTAAAGGCACACCAGGTGACTGGAGTCATATTATCAAACAAATTGGAATG
 
. : . : . : . : . : . :
rJMFF017F14+ TTTACTTTCACGGGATTGAATGCTGAGCAAGTTGCCTTTATGACCCGAAAGCATCACATC
rJMFF004C15+ TTTACTTTCACGGGATTGAATGCTGAGCAAGTTGCCTTTATGACCCGAAAGCATCACATC
rJMFF026M08+ TTTACTTTCACGGGATTGAATGCTGAGCAAGTTGCCTTTATGACCCGAAAGCATCACATC
rJMFF012N21+ TTTACTTTCACGGGATTGAATGNTGAGCAAGTTGCCTTTATGACCCGAAAGCATCACATC
rJMFF007P24+ TTTACTTTCACGGGATTGAATGCTGAGCAAGTTGCCTTTATGACCCGAAAGCATCACATC
rJMFF041M07+ TTTACTTTCACGGGATTGAATGCTGAGCAAGTTGCCTTTATGACCCGAAAGCATCACATC
                      ____________________________________________________________
consensus TTTACTTTCACGGGATTGAATGCTGAGCAAGTTGCCTTTATGACCCGAAAGCATCACATC
 
. : . : . : . : . : . :
rJMFF017F14+ TACATGACAGCTGATGGGAGAATTAGCATGGCAGGGCTTAGTTCTGAGAAAGTTCCTCAT
rJMFF004C15+ TACATGACAGCTGATGGGAGAATTAGCATGGCAGGGCTTAGTTCTGAGAAAGTTCCTCAT
rJMFF026M08+ TACATGACAGCTGATGGGAGAATTAGCATGGCAGGGCTTAATTCTGAGAAAGTTCCTCAT
rJMFF012N21+ TACATGACAGNTGATGGGAGAATTAGCATGGCAGGGNTTAGTTCTGAGAAAGTTCCTCAT
rJMFF007P24+ TACATGACAGCTGATGGGAGAATTAGCATGGCAGGGCTTAATTCTGAGAAAGTTCCTCAT
rJMFF041M07+ TACATGACAGCTGATGGGAGAATTAGCATGGCAGGGCTTAATTCTGAGAAAGTTCCTCAT
                      ____________________________________________________________
consensus TACATGACAGCTGATGGGAGAATTAGCATGGCAGGGCTTAGTTCTGAGAAAGTTCCTCAT
 
. : . : . : . : . : . :
rJMFF017F14+ CTTGCTGAAGCAATACATGCAGCAGTTACCAAATTAGCCTAAATCTATAGTTTACAGAAG
rJMFF004C15+ CTTGCTGAAGCAATACATGCAGCAGTTACCAAATTAGCCTAAATCTATAGTTTACAGAAG
rJMFF026M08+ CTTGCTGAAGCAATACATGCAGCAGTTACCAAATTAGCCTAAATCTATAGTTTACAGAAG
rJMFF012N21+ NTTGNTGAAGCAATACATGCAGCAGTTACCAAATTAGCCTAAATCTATAGTTTACAGAAG
rJMFF007P24+ CTTGCTGAAGCAATACATGCAGCAGTTACCAAATTAGCCTAAATCTATAGTTTACAGAAG
rJMFF041M07+ CTTGCTGAAGCAATACATGCAGCAGTTACCAAATTAGCCTAAATCTATAGTTTACAGAAG
                      ____________________________________________________________
consensus CTTGCTGAAGCAATACATGCAGCAGTTACCAAATTAGCCTAAATCTATAGTTTACAGAAG
 
. : . : . : . : . : . :
rJMFF017F14+ CCTTTTGTCAATAAGTTTTCAGTTTTGAGCTTGACTTTCTATGTATTTTGATACTGCTTG
rJMFF004C15+ CCTTTTGTCAATAAGTTTTCAGTTTTGAGCTTGACTTTCTATGTATTTTGATACTGCTTG
rJMFF026M08+ CCTTTTGTCAATAAGTTTTCAGTTTTGAGCTTGACTTTCTATGTATTTTGATACTGCTTG
rJMFF012N21+ CCTTTTGTCAATAAGTTTTCAGTTTTGAGCTTGACTTTCTATGTATTTTGATACTGCTTG
rJMFF007P24+ CCTTTTGTCAATAAGTTTTCAGTTTTGAGCTTGACTTTCTATGTATTTTGATACTGCTTG
rJMFF041M07+ CCTTTTGTCAATAAGTTTTCAGTTTTGAGCTTGACTTTCTATGTATTTTGATACTGCTTG
                      ____________________________________________________________
consensus CCTTTTGTCAATAAGTTTTCAGTTTTGAGCTTGACTTTCTATGTATTTTGATACTGCTTG
 
. : . : . : . : . : . :
rJMFF017F14+ AAATGGATTCAAA
rJMFF004C15+ AAATGGATCCAAATAAAATTTCACC
rJMFF026M08+ AAATGGATTCAAATAAAATTTCACCATGGACACATGGAGACATCATTTTGAATGTAATCA
rJMFF012N21+ AAATGGATTCAAATAAAATTTCACCA
rJMFF007P24+ AAATGGATTCAAATAAAATTTCACCATGGACACATGGAGACATCATTTTGAATGTAATCA
rJMFF041M07+ AAATGGATTCAAATAAAATTTCACCATGGACACATGGAGACATCATTTTGAATGTAATCA
                      ____________________________________________________________
consensus AAATGGATTCAAATAAAATTTCACCATGGACACATGGAGACATCATTTTGAATGTAATCA
 
. : . : . : . : . : . :
rJMFF026M08+ TTTCGCCTAACAGGGAATTTTTCTTATTAATATTAT
rJMFF007P24+ TTTCGCCTAACAGGGAATTTTTCTTATTAATATTAT
rJMFF041M07+ TTTCGCCTAACAGGGAATTTTTCTTATTAATATTATCAACCCTGTTAGCTCATTAGCCTT
                      ____________________________________________________________
consensus TTTCGCCTAACAGGGAATTTTTCTTATTAATATTATCAACCCTGTTAGCTCATTAGCCTT