Previous Contig 010160:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007F13Sequence540010160 (6)gb:BT006486_16393733e-67Arabidopsis thaliana At5g49760 gene, complete cds.>gb:AK117123_1815170 Arabidops634010160 (6)gb:BT006486_16393735e-48Arabidopsis thaliana At5g49760 gene, complete cds.>gb:AK117123_1815170 Arabidops
JMFF041L23Sequence647002125 (13)gb:AK117863_18158732e-43Arabidopsis thaliana At1g79620 mRNA for unknown protein, complete cds, clone: RA622010160 (6)gb:BT006486_16393733e-50Arabidopsis thaliana At5g49760 gene, complete cds.>gb:AK117123_1815170 Arabidops
JMFF049N03Sequence633002125 (13)gb:AK117863_18158739e-40Arabidopsis thaliana At1g79620 mRNA for unknown protein, complete cds, clone: RA646010160 (6)gb:AB025613_15163732e-79Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2I5.
JMSF020A02Sequence680002125 (13)gb:BT006486_16393734e-40Arabidopsis thaliana At5g49760 gene, complete cds.>gb:AK117123_1815170 Arabidops709010160 (6)gb:BT006486_16393736e-67Arabidopsis thaliana At5g49760 gene, complete cds.>gb:AK117123_1815170 Arabidops
JMSF048C05Sequence692002125 (13)gb:AK117863_18158732e-56Arabidopsis thaliana At1g79620 mRNA for unknown protein, complete cds, clone: RA753010160 (6)gb:BT006486_16393732e-75Arabidopsis thaliana At5g49760 gene, complete cds.>gb:AK117123_1815170 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF049N03+ GCCAAAAGAGAAAAGCTCAAGATGCAGCTAAAAAGAATGATC
                      ____________________________________________________________
consensus GCCAAAAGAGAAAAGCTCAAGATGCAGCTAAAAAGAATGATC
 
. : . : . : . : . : . :
rJMFF049N03+ CTTTCGCATCCTGGGATCGATCCAAAAGCAGTGGCGCTGTCCCCCAACTACAGGGAGCAA
                      ____________________________________________________________
consensus CTTTCGCATCCTGGGATCGATCCAAAAGCAGTGGCGCTGTCCCCCAACTACAGGGAGCAA
 
. : . : . : . : . : . :
rJMFF049N03+ AGTTTTTCTCGTTGAAGAGCTCGCGAAATGCACAAATAACTTCTCAGAAGCCAATACTGT
                      ____________________________________________________________
consensus AGTTTTTCTCGTTGAAGAGCTCGCGAAATGCACAAATAACTTCTCAGAAGCCAATACTGT
 
. : . : . : . : . : . :
rJMFF049N03+ TGGATCTGGAGGTTATGGGAAGGTATACAGAGGAATTCTTCCTCATGGACAACTAATTCC
                      ____________________________________________________________
consensus TGGATCTGGAGGTTATGGGAAGGTATACAGAGGAATTCTTCCTCATGGACAACTAATTCC
 
. : . : . : . : . : . :
rJMFF049N03+ CATCAAAAGATCTCAGCAAGGATCTATGCAGGGCGCTCCCGAGTTCAAATCTGAGATTGA
                      ____________________________________________________________
consensus CATCAAAAGATCTCAGCAAGGATCTATGCAGGGCGCTCCCGAGTTCAAATCTGAGATTGA
 
. : . : . : . : . : . :
rJMFF049N03+ GCTTCTCTCGAGGGTTCACCACAAGAACGTCGTTGACCTTGTTGGGTTTTGTTTTGATCA
                      ____________________________________________________________
consensus GCTTCTCTCGAGGGTTCACCACAAGAACGTCGTTGACCTTGTTGGGTTTTGTTTTGATCA
 
. : . : . : . : . : . :
rJMFF049N03+ AGGCGAACAGATACTAATCTATGAATTTATACCAAATGGTACACTGAAAGAAAGTCTGAC
                      ____________________________________________________________
consensus AGGCGAACAGATACTAATCTATGAATTTATACCAAATGGTACACTGAAAGAAAGTCTGAC
 
. : . : . : . : . : . :
rJMFF049N03+ AGGGAAATCTGGAATCAAGTTAGATTGGATGAGGAGACTTAGGATTGCTCTTGGAGCGGC
JMFF007F13- AGCGGC
rJMSF048C05+ AGCGGC
                      ____________________________________________________________
consensus AGGGAAATCTGGAATCAAGTTAGATTGGATGAGGAGACTTAGGATTGCTCTTGGAGCGGC
 
. : . : . : . : . : . :
rJMFF049N03+ CAAAGGGCTGCAGTATCTTCATGACCTTGTAAACCCGCCCATCA-TCCACCGCGACATCA
rJMSF020A02+ CGCCCATCATTCCANCGCGACATCA
JMFF007F13- CAAAGGGCTGCAGTATCTTCATGACCTTGTAAACCCGCCCATCA-TCCACCGCGACATCA
rJMSF048C05+ CAAAGGGCTGCAGTATCTTCATGACCTTGTAAACCCGCCCATCA-TCCACCGCGACATCA
                      ____________________________________________________________
consensus CAAAGGGCTGCAGTATCTTCATGACCTTGTAAACCCGCCCATCA-TCCACCGCGACATCA
 
. : . : . : . : . : . :
rJMFF049N03+ AAACAAATAATATTCTGCTGGATGAACGCTTGAATGCTAAAGTTGCAGATTTCGGTCTCT
rJMSF020A02+ AAACAAATAATATTCTGCTGGATGAACGCTTGAATGCTAAAGTTGCAGATTTCGGTCTCT
JMFF007F13- AAACAAATAATATTCTGCTGGATGAACGCTTGAATGCTAAAGTTGCAGATTTCGGTCTCT
rJMSF048C05+ AAACAAATAATATTCTGCTGGATGAACGCTTGAATGCTAAAGTTGCAGATTTCGGTCTCT
                      ____________________________________________________________
consensus AAACAAATAATATTCTGCTGGATGAACGCTTGAATGCTAAAGTTGCAGATTTCGGTCTCT
 
. : . : . : . : . : . :
rJMFF049N03+ CCAAGTCTCTAGGCGAACAAGAGAAGGCTCATGTCACCACTCAAGTTAAAGGAACTATGG
rJMSF020A02+ CCAAGTCTCTAGGCGAACAAGAGAAGGCTCATGTCACCACTCAAGTTAAAGGAACTATGG
JMFF007F13- CCAAGTCTCTAGGCGAACAAGAGAAGGCTCATGTCACCACTCAAGTTAAAGGAACTATGG
rJMSF048C05+ CCAAGTCTCTAGGCGAACAAGAGAAGGCTCATGTCACCACTCAAGTTAAAGGAACTATGG
rJMFF007F13+ GCGAACAAGAGAAGGCTCATGTCACCACTCAAGTTAAAGGAACTATGG
rJMFF041L23+ CACTCAAGTTAAAGGAACTATGG
                      ____________________________________________________________
consensus CCAAGTCTCTAGGCGAACAAGAGAAGGCTCATGTCACCACTCAAGTTAAAGGAACTATGG
 
. : . : . : . : . : . :
rJMFF049N03+ GGTAC
rJMSF020A02+ GGTACTTGGATCCCGAATATTACATGACGAACCAGTTGACAGAGAAGAGCGATGTTTACA
JMFF007F13- GGTACTTGGATCCCGAATATTACATGACGAACCAGTCGACAGAGAAGAGCGATGTTTACA
rJMSF048C05+ GGTACTTGGATCCCGAATATTACATGACGAACCAGTTGACAGAGAAGAGCGATGTTTACA
rJMFF007F13+ GGTACTTGGATCCCGAATATTACATGACGAACCAGTCGACAGAGAAGAGCGATGTTTACA
rJMFF041L23+ GGTACTTGGATCCCGAATATTACATGACGAACCAGTTGACAGAGAAGAGCGATGTTTACA
                      ____________________________________________________________
consensus GGTACTTGGATCCCGAATATTACATGACGAACCAGTTGACAGAGAAGAGCGATGTTTACA
 
. : . : . : . : . : . :
rJMSF020A02+ GCTTCGGGGTGGTGCTTCTGGAGATTATAACCGCAAGGCCGCCTATCGAGAAAGGAAAGT
JMFF007F13- GCTTCGGGGTGGTGCTTCTGGAGATTATAACCGCAAGGCCGCCTATCGAGAAAGGAAAGT
rJMSF048C05+ GCTTCGGGGTGGTGCTTCTGGAGATTATAACCGCAAGGCCGCCTATCGAGAAAGGAAAGT
rJMFF007F13+ GCTTCGGGGTGGTGCTTCTGGAGATTATAACCGCAAGGCCGCCTATCGAGAAAGGAAAGT
rJMFF041L23+ GCTTCGGGGTGGTGCTTCTGGAGATTATAACCGCAAGGCCGCCTATCGAGAAAGGAAAGT
                      ____________________________________________________________
consensus GCTTCGGGGTGGTGCTTCTGGAGATTATAACCGCAAGGCCGCCTATCGAGAAAGGAAAGT
 
. : . : . : . : . : . :
rJMSF020A02+ ACATTGTTCGGGAAGTGAAGCAAGCAATGGACAAGACTAAAGACATGTACGACCTTCAAA
JMFF007F13- ACATTGTTCGGGAAGTGAAGCAAGCAATGGACAAGACTAAAGACATGTACGACCTTCAAA
rJMSF048C05+ ACATTGTTCGGGAAGTGAAGCAAGCAATGGACAAGACTAAAGACATGTACGACCTTCAAA
rJMFF007F13+ ACATTGTTCGGGAAGTGAAGCAAGCAATGGACAAGACTAAAGACATGTACGACCTTCAAA
rJMFF041L23+ ACATTGTTCGGGAAGTGAAGCAAGCAATGGACAAGACTAAAGACATGTACGACCTTCAAA
                      ____________________________________________________________
consensus ACATTGTTCGGGAAGTGAAGCAAGCAATGGACAAGACTAAAGACATGTACGACCTTCAAA
 
. : . : . : . : . : . :
rJMSF020A02+ GCATTCTCGACCCGTCCATTGCCTCGAGCGTGACGCCTAGAAGTCTAGAGAAGTTCGTCG
JMFF007F13- GCATTCTCGACCCGTCCATTGCCTCGAGCGTGACGCCTAGAAGTCTAGAGAAGTTCGTCG
rJMSF048C05+ GCATTCTCGACCCGTCCATTGCCTCGAGCGTGACGCCTAGAAGTCTAGAGAAGTTCGTCG
rJMFF007F13+ GCATTCTCGACCCGTCCATTGCCTCGAGCGTGACGCCTAGAAGTCTAGAGAAGTTCGTCG
rJMFF041L23+ GCATTCTCGACCCGTCCATTGCCTCGAGCGTGACGCCTAGAAGTCTAGAGAAGTTCGTCG
                      ____________________________________________________________
consensus GCATTCTCGACCCGTCCATTGCCTCGAGCGTGACGCCTAGAAGTCTAGAGAAGTTCGTCG
 
. : . : . : . : . : . :
rJMSF020A02+ ATGTAGCCTTGAGGTGTCTCGAAGACGTGGCGGCCCAACGCCCAACAATGCGAGAAGTGG
JMFF007F13- ATGTAGCCTTGAGGTGTCTCGAAGACGTGGCGGCCCAACGCCCAACAATGCGAGAAGTGG
rJMSF048C05+ ATGTAGCCTTGAGGTGTCTCGAAGACGTGGCGGCCCAACGCCCAACAATGCGAGAAGTGG
rJMFF007F13+ ATGTAGCCTTGAGGTGTCTCGAAGACGTGGCGGCCCAACGCCCAACAATGCGAGAAGTGG
rJMFF041L23+ ATGTAGCCTTGAGGTGTCTCGAAGACGTGGCGGCCCAACGCCCAACAATGCGAGAAGTGG
                      ____________________________________________________________
consensus ATGTAGCCTTGAGGTGTCTCGAAGACGTGGCGGCCCAACGCCCAACAATGCGAGAAGTGG
 
. : . : . : . : . : . :
rJMSF020A02+ TGAAAGAGATCGAGAGCATCATGGAAATGGTGGGGCTAAACCCTCACGCCGACTCGGCTT
JMFF007F13- TGAAAGAGATCGAGAGCATCATGGAAATGGTGGGGCTAAACCCTCACGCCGACTC
rJMSF048C05+ TGAAAGAGATCGAGAGCATCATGGAAATGGTGGGGCTAAACCCTCACGCCGACTCGGCTT
rJMFF007F13+ TGAAAGAGATCGAGAGCATCATGGAAATGGTGGGGCTAAACCCTCACGCCGACTCGGCTT
rJMFF041L23+ TGAAAGAGATCGAGAGCATCATGGAAATGGTGGGGCTAAACCCTCACGCCGACTCGGCTT
                      ____________________________________________________________
consensus TGAAAGAGATCGAGAGCATCATGGAAATGGTGGGGCTAAACCCTCACGCCGACTCGGCTT
 
. : . : . : . : . : . :
rJMSF020A02+ CGACTTCAGAGAGCTATTCGGGAGTGAGCAAAGGCTCCGAACATCCTTACAGCGACGAAA
rJMSF048C05+ CGACTTCAGAGAGCTATTCGGGAGTGAGCAAAGGCTCCGAACATCCTTACAGCGACGAAA
rJMFF007F13+ CGACTTCAGAGAGCTATTCGTGAGTGAGCAAAGGCTCCGAACATCCTTACAGCGACGAAA
rJMFF041L23+ CGACTTCAGAGAGCTATTCGGGAGTGAGCAAAGGCTCCGAACATCCTTACAGCGACGAAA
                      ____________________________________________________________
consensus CGACTTCAGAGAGCTATTCGGGAGTGAGCAAAGGCTCCGAACATCCTTACAGCGACGAAA
 
. : . : . : . : . : . :
rJMSF020A02+ GCCTCTCGGTCTACACTGGGGTGCTTCCCAAGTGAAGATAAAAACAGTTTTTCGAGTGTT
rJMSF048C05+ GCCTCTCGGTCTACACTGGGGTGCTTCCCAAGTGAAGATAAAAACAGTTTTTCGAGTGTT
rJMFF007F13+ GCCTCTCGGTCTACACTGGGGTGCTTCCCAAGTGAAGATAAAAACAGTTTTTCGAGTGTT
rJMFF041L23+ GCCTCTCGGTCTACACTGGGGTGCTTCCCAAGTGAAGATAAAAACAGTTTTTCGAGTGTT
                      ____________________________________________________________
consensus GCCTCTCGGTCTACACTGGGGTGCTTCCCAAGTGAAGATAAAAACAGTTTTTCGAGTGTT
 
. : . : . : . : . : . :
rJMSF020A02+ TGAACAACTTTTTGTTCTATTGNGACATTTCTATATGTNNGCATTATTTCNTGGAGAATG
rJMSF048C05+ TGAACAACTTTTTGTTCTATTGTGACATTTCTATATGTTTGCATTATTTCTTGGAGAATG
rJMFF007F13+ TGAACAACTTTTTGTTCTATTGTGACATTTCTATATGTTTGCATTATTTCTTGGAGAATG
rJMFF041L23+ TGAACAACTTTTTGTTCTATTGTGACATTTCTATATGTTTGCATTATTTCTTGGAGAATG
                      ____________________________________________________________
consensus TGAACAACTTTTTGTTCTATTGTGACATTTCTATATGTTTGCATTATTTCTTGGAGAATG
 
. : . : . : . : . : . :
rJMSF020A02+ GAGATGGAT-CAAGTGTATAGTAGC
rJMSF048C05+ GAGATGGATCCAAGTGTATAGTAGC
rJMFF007F13+ GAGATGGAT-CAAGTGTATAGTAGCATATATATTA-TGAATGGCAAAT
rJMFF041L23+ GAGATGGAT-CAAGTGTATAGTAGCATATATATTATTGAATGGCAAATCTGAATTGACCG
                      ____________________________________________________________
consensus GAGATGGAT-CAAGTGTATAGTAGCATATATATTATTGAATGGCAAATCTGAATTGACCG