Previous Contig 010158:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008O11Sequence549000464 (8)gb:AB029462_15181961e-40Salix gilgiana SgGN1 mRNA for beta-1,3-glucanase, partial cds.765010158 (8)gb:AB029462_15181962e-82Salix gilgiana SgGN1 mRNA for beta-1,3-glucanase, partial cds.
JMFF017F16Sequence576000464 (8)gb:ATAC009853_15430396e-45Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc765010158 (8)gb:AB029462_15181962e-82Salix gilgiana SgGN1 mRNA for beta-1,3-glucanase, partial cds.
JMFF023A11Sequence499000464 (8)gb:ATAC009853_15430392e-34Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc683010158 (8)gb:AB029462_15181961e-67Salix gilgiana SgGN1 mRNA for beta-1,3-glucanase, partial cds.
JMFF028O12Sequence468000464 (8)gb:AB029462_15181962e-33Salix gilgiana SgGN1 mRNA for beta-1,3-glucanase, partial cds.622010158 (8)gb:AB029462_15181962e-59Salix gilgiana SgGN1 mRNA for beta-1,3-glucanase, partial cds.
JMFF029C01Sequence455000464 (8)gb:AB029462_15181962e-33Salix gilgiana SgGN1 mRNA for beta-1,3-glucanase, partial cds.767010158 (8)gb:AB029462_15181962e-78Salix gilgiana SgGN1 mRNA for beta-1,3-glucanase, partial cds.
JMFF040K21Sequence498000464 (8)gb:ATAC009853_15430391e-33Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc661010158 (8)gb:AB029462_15181967e-69Salix gilgiana SgGN1 mRNA for beta-1,3-glucanase, partial cds.
JMFF041L16Sequence639000464 (8)gb:AB029462_15181963e-54Salix gilgiana SgGN1 mRNA for beta-1,3-glucanase, partial cds.592010158 (8)gb:AB029462_15181964e-51Salix gilgiana SgGN1 mRNA for beta-1,3-glucanase, partial cds.
JMSF033L13Sequence662000464 (8)gb:AB029462_15181962e-68Salix gilgiana SgGN1 mRNA for beta-1,3-glucanase, partial cds.713010158 (8)gb:AB029462_15181962e-76Salix gilgiana SgGN1 mRNA for beta-1,3-glucanase, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF029C01+ CGGAA
rJMFF017F16+ GGAA
rJMFF008O11+ GGAA
                      ____________________________________________________________
consensus CGGAA
 
. : . : . : . : . : . :
rJMFF029C01+ ACGGGTTGGCCCAACGGCGGCGACGTCGATCAAATCGGCGCGAGTATTTATAATTCCGCC
rJMFF017F16+ ACGGGTTGGCCCAACGGCGGCGACGTCGATCAAATCGGCGCGAGTATTTATAATTCCGCC
rJMSF033L13+ GACGTCGATCAAATCGGCGCGAGTATTTATAATTCCGCC
rJMFF008O11+ ACGGGTTGGCCCAACGGCGGNGACGTCGATCAAATCGGCGCGAGTATTTATAATTCCGCC
                      ____________________________________________________________
consensus ACGGGTTGGCCCAACGGCGGCGACGTCGATCAAATCGGCGCGAGTATTTATAATTCCGCC
 
. : . : . : . : . : . :
rJMFF029C01+ ACGTATAACCGGAACGTGGTGAAGAAGTTTACCTCGAAGGTGGGGGACGCCGGCGAGGCC
rJMFF017F16+ ACGTATAACCGGAACGTGGTGAAGAAGTTTACCTCGAAGGT-GGGGACGCCGGCGAGGCC
rJMSF033L13+ ACGTATAACCGGAACGTGGTGAAGAAGTTTACCTCGAAGGT-GGGGACGCCGGCGAGGCC
rJMFF023A11+ GTGAAGAAGTTTACCTCGAAGGT-GGGGACGCCGGCGAGGCC
rJMFF040K21+ AACGTGGTGAAGAAGTTTACCTCGAAGGT-GGGGACGCCGGCGAGGCC
rJMFF008O11+ ACGTATAACCGGAACGTGGTGAAGAAGTTTACCTCGAAGGT-GGGGACGCCGGCGAGGCC
                      ____________________________________________________________
consensus ACGTATAACCGGAACGTGGTGAAGAAGTTTACCTCGAAGGT-GGGGACGCCGGCGAGGCC
 
. : . : . : . : . : . :
rJMFF029C01+ GGGCGTGGTAATTCCGACGCTTATTTTCGCTCTGTATAACGAGAACCAGAAACCGGGTCC
rJMFF017F16+ GGGCGTGGTAATTCCGACGCTTATTTTCGCTCTGTATAACGAGAACCAGAAACCGGGTCC
rJMSF033L13+ GGGCGTGGTAATTCCGACGCTTATTTTCGCTCTGTATAACGAGAACCAGAAACCGGGTCC
rJMFF023A11+ GGGCGTGGTAATTCCGACGCTTATTTTCGCTCTGTATAACGAGAACCAGAAACCGGGTCC
rJMFF040K21+ GGGCGTGGTAATTCCGACGCTTATTTTCGCTCTGTATAACGAGAACCAGAAACCGGGTCC
rJMFF028O12+ TTATTTTCGCTCTGTATAACGAGANCCAGAAACCGGGTCC
rJMFF008O11+ GGGCGTGGTAATTCCGACGCTTATTTTCGCTCTGTATAACGAGAACCAGAAACCGGGTCC
                      ____________________________________________________________
consensus GGGCGTGGTAATTCCGACGCTTATTTTCGCTCTGTATAACGAGAACCAGAAACCGGGTCC
 
. : . : . : . : . : . :
rJMFF029C01+ GGGTACGGAGCGGCATTTCGGGGTGTTGTACCCGAACGGGACCAACATTTACCCGATTGA
rJMFF017F16+ GGGTACGGAGCGGCATTTCGGGGTGTTGTACCCGAACGGGACCAACATTTACCCGATTGA
rJMSF033L13+ GGGTACGGAGCGGCATTTCGGGGTGTTGTACCCGAACGGGACCAACATTTACCCGATTGA
rJMFF023A11+ GGGTACGGAGCGGCATTTCGGGGTGTTGTACCCGAACGGGACCAACATTTACCCGATTGA
rJMFF040K21+ GGGTACGGAGCGGCATTTCGGGGTGTTGTACCCGAACGGGACCAACATTTACCCGATTGA
rJMFF028O12+ GGGTACGGAGCGGCATTTCGGGGTGTTGTACCCGAACGGGACCAACATTTACCCGATTGA
rJMFF008O11+ GGGTACGGAGCGGCATTTCGGGGTGTTGTACCCGAACGGGACCAACATTTACCCGATTGA
rJMFF041L16+ GAGCGGCATTTCGGGGTGTTGTACCCGAACGGGACCAACATTTACCCGATTGA
                      ____________________________________________________________
consensus GGGTACGGAGCGGCATTTCGGGGTGTTGTACCCGAACGGGACCAACATTTACCCGATTGA
 
. : . : . : . : . : . :
rJMFF029C01+ CCTGTCGGGGAAGACGCCGGAATCCGAATTCCCGCCGCTGCCGAAGCCGACGACCAACCA
rJMFF017F16+ CCTGTCGGGGAAGACGCCGGAATCCGAATTCCCGCCGCTGCCGAAGCCGACGACCAACCA
rJMSF033L13+ CCTGTCGGGGAAGACGCCGGAATCCGAATTCCCGCCGCTGCCGAAGCCGACGACCAACCA
rJMFF023A11+ CCTGTCGGGGAAGACGCCGGAATCCGAATTCCCGCCGCTGCCGAAGCCGACGACCAACCA
rJMFF040K21+ CCTGTCGGGGAAGACGCCGGAATCCGAATTCCCGCCGCTGCCGAAGCCGACGACCAACCA
rJMFF028O12+ CCTGTCGGGGAAGACGCCGGAATCCGAATTCCCGCCGCTGCCGAAGCCGACGACCAACCA
rJMFF008O11+ CCTGTCGGGGAAGACGCCGGAATCCGAATTCCCGCCGCTGCCGAAGCCGACGACCAACCA
rJMFF041L16+ CCTGTCGGGGAAGACGCCGGAATCCGAATTCCCGCCGCTGCCGAAGCCGACGACCAACCA
                      ____________________________________________________________
consensus CCTGTCGGGGAAGACGCCGGAATCCGAATTCCCGCCGCTGCCGAAGCCGACGACCAACCA
 
. : . : . : . : . : . :
rJMFF029C01+ ACCGTACAAAGGAAAAGTTTGGTGCGTGGTGGCTCCGGCGGCGAATCTAACCGCGGTGGC
rJMFF017F16+ ACCGTACAAAGGAAAAGTTTGGTGCGTGGTGGCTCCGGCGGCGAATCTAACCGCGGTGGC
rJMSF033L13+ ACCGTACAAAGGAAAAGTTTGGTGCGTGGTGGCTCCGGCGGCGAATCTAACCGCGGTGGC
rJMFF023A11+ ACCGTACAAAGGAAAAGTTTGGTGCGTGGTGGCTCCGGCGGCGAATCTAACCGCGGTGGC
rJMFF040K21+ ACCGTACAAAGGAAAAGTTTGGTGCGTGGTGGCTCCGGCGGCGAATCTAACCGCGGTGGC
rJMFF028O12+ ACCGTACAAAGGAAAAGTTTGGTGCGTGGTGGCTCCGGCGGCGAATCTAACCGCGGTGGC
rJMFF008O11+ ACCGTACAAAGGAAAAGTTTGGTGCGTGGTGGCTCCGGCGGCGAATCTAACCGCGGTGGC
rJMFF041L16+ ACCGTACAAAGGAAAAGTTTGGTGCGTGGTGGCTCCGGCGGCGAATCTAACCGCGGTGGC
                      ____________________________________________________________
consensus ACCGTACAAAGGAAAAGTTTGGTGCGTGGTGGCTCCGGCGGCGAATCTAACCGCGGTGGC
 
. : . : . : . : . : . :
rJMFF029C01+ CGACGCTTTATCGTACGCTTGCGGGCAGGGTAATCGGACCTGCAACCCGATCCAACCGGG
rJMFF017F16+ CGACGCTTTATCGTACGCTTGCGGGCAGGGTAATCGGACCTGCAACCCGATCCAACCGGG
rJMSF033L13+ CGACGCTTTATCGTACGCTTGCGGGCAGGGTAATCGGACCTGCAACCCGATCCAACCGGG
rJMFF023A11+ CGACGCTTTATCGTACGCTTGCGGGCAGGGTAATCGGACCTGCAACCCGATCCAACCGGG
rJMFF040K21+ CGACGCTTTATCGTACGCTTGCGGGCAGGGTAATCGGACCTGCAACCCGATCCAACCGGG
rJMFF028O12+ CGACGCTTTATCGTACGCTTGCGGGCAGGGTAATCGGACCTGCAACCCGATCCAACCGGG
rJMFF008O11+ CGACGCTTTATCGTACGCTTGCGGGCAGGGTAATCGGACCTGCAACCCGATCCAACCGGG
rJMFF041L16+ CGACGCTTTATCGTACGCTTGCGGGCAGGGTAATCGGACCTGCAACCCGATCCAACCGGG
                      ____________________________________________________________
consensus CGACGCTTTATCGTACGCTTGCGGGCAGGGTAATCGGACCTGCAACCCGATCCAACCGGG
 
. : . : . : . : . : . :
rJMFF029C01+ CGGCGCGTGTTACAACCCGAACTCATTGATCCGCCATGCGAGCTATGCTTTCAGTTCGTA
rJMFF017F16+ CGGCGCGTGTTACAACCCGAACTCATTGATCCGCCATGCGAGCTATGCTTTCAGTTCGTA
rJMSF033L13+ CGGCGCGTGTTACAACCCGAACTCATTGATCCGCCATGCGAGCTATGCTTTCAGTTCGTA
rJMFF023A11+ CGGCGCGTGTTACAACCCGAACTCATTGATCCGCCATGCGAGCTATGCTTTCAGTTCGTA
rJMFF040K21+ CGGCGCGTGTTACAACCCGAACTCATTGATCCGCCATGCGAGCTATGCTTTCAGTTCGTA
rJMFF028O12+ CGGCGCGTGTTACAACCCGAACTCATTGATCCGCCATGCGAGCTATGCTTTCAGTTCGTA
rJMFF008O11+ CGGCGCGTGTTACAACCCGAACTCATTGATCCGCCATGCGAGCTATGCTTTCAGTTCGTA
rJMFF041L16+ CGGCGCGTGTTACAACCCGAACTCATTGATCCGCCATGCGAGCTATGCTTTCAGTTCGTA
                      ____________________________________________________________
consensus CGGCGCGTGTTACAACCCGAACTCATTGATCCGCCATGCGAGCTATGCTTTCAGTTCGTA
 
. : . : . : . : . : . :
rJMFF029C01+ CTGGGCACAGTTTCGCAGTCTCGGCGGGACATGTTACTTCAACGGACTCGCCGTTAAGAC
rJMFF017F16+ CTGGGCACAGTTTCGCAGTCTCGGCGGGACATGTTACTTCAACGGACTCGCCGTTAAGAC
rJMSF033L13+ CTGGGCACAGTTTCGCAGTCTCGGCGGGACATGTTACTTCAACGGACTCGCCGTTAAGAC
rJMFF023A11+ CTGGGCACAGTTTCGCAGTCTCGGCGGGACATGTTACTTCAACGGACTCGCCGTTAAGAC
rJMFF040K21+ CTGGGCACAGTTTCGCAGTCTCGGCGGGACATGTTACTTCAACGGACTCGCCGTTAAGAC
rJMFF028O12+ CTGGGCACAGTTTCGCAGTCTCGGCGGGACATGTTACTTCAACGGACTCGCCGTTAAGAC
rJMFF008O11+ CTGGGCACAGTTTCGCAGTCTCGGCGGGACATGTTACTTCAACGGACTCGCCGTTAAGAC
rJMFF041L16+ CTGGGCACAGTTTCGCAGTCTCGGCGGGACATGTTACTTCAACGGACTCGCCGTTAAGAC
                      ____________________________________________________________
consensus CTGGGCACAGTTTCGCAGTCTCGGCGGGACATGTTACTTCAACGGACTCGCCGTTAAGAC
 
. : . : . : . : . : . :
rJMFF029C01+ AATCAATGATCCCAGTTATGGAGCATGCAAGTACCCCAGTATTACACTTTGATGGCGAAG
rJMFF017F16+ AATCAATGATCCCAGTTATGGAGCATGCAAGTACCCCAGTATTACACTTTGATGGCGAAG
rJMSF033L13+ AATCAATGATCCCAGTTATGGAGCATGCAAGTACCCCAGTATTACACTTTGATGGCGAAG
rJMFF023A11+ AATCAATGATCCCAGTTATGGAGCATGCAAGTACCCCAGTATTACACTTTGATGGCGAAG
rJMFF040K21+ AATCAATGATCCCAGTTATGGAGCATGCAAGTACCCCAGTATTACACTTTGATGGCGAAG
rJMFF028O12+ AATCAATGATCCCAGTTATGGAGCATGCAAGTACCCCAGTATTACACTTTGATGGCGAAG
rJMFF008O11+ AATCAATGATCCCAGTTATGGAGCATGCAAGTACCCCAGTATTACACTTTGATGGCGAAG
rJMFF041L16+ AATCAATGATCCCAGTTATGGAGCATGCAAGTACCCCAGTATTACACTTTGATGGCGAAG
                      ____________________________________________________________
consensus AATCAATGATCCCAGTTATGGAGCATGCAAGTACCCCAGTATTACACTTTGATGGCGAAG
 
. : . : . : . : . : . :
rJMFF029C01+ AAGTAGTCGCCGCCGGCGAGACCAGAAGACACCGGAAAACTGATAGAAAAGCAACAAATG
rJMFF017F16+ AAGTAGTCGCCGCCGGCGAGACCAGAAGACACCGGAAAACTGATAGAAAAGCAACAAATG
rJMSF033L13+ AAGTAGTCGCCGCCGGCGAGACCAGAAGACACCGGAAAACTGATAGAAAAGCAACAAATG
rJMFF023A11+ AAGTAGTCGCCGCCGGCGAGACCAGAAGACACCGGAAAACTGATAGAAAAGCAACAAATG
rJMFF040K21+ AAGTAGTCGCCGCCGGCGAGACCAGAAGACACCGGAAAACTGATAGAAAAGCAACAAATG
rJMFF028O12+ AAGTAGTCGCCGCCGGCGAGACCAGAAGACACCGGAAAACTGATAGAAAAGCAACAAATG
rJMFF008O11+ AAGTAGTCGCCGCCGGCGAGACCAGAAGACACCGGAAAACTGATAGAAAAGCAACAAATG
rJMFF041L16+ AAGTAGTCGCCGCCGGCGAGACCAGAAGACACCGGAAAACTGATAGAAAAGCAACAAATG
                      ____________________________________________________________
consensus AAGTAGTCGCCGCCGGCGAGACCAGAAGACACCGGAAAACTGATAGAAAAGCAACAAATG
 
. : . : . : . : . : . :
rJMFF029C01+ TTTTCCTTAACACCATTTATCCTTAAACCATCATAATCCTGTTCTTGAAGTTATACGTTG
rJMFF017F16+ TTTTCCTTAACACCATTTATCCTTAAACCATCATAATCCTGTTCTTGAAGTTATACGTTG
rJMSF033L13+ TTTTCCTTAACACCATTTATCCTTAAACCATCATAATCCTGTTCTTGAAGTTATACGTTG
rJMFF023A11+ TTTTCCTTAACACCATTTATCCTTAAACCATCATAATCCTGTTCTTGAAGTTATACGTTG
rJMFF040K21+ TTTTCCTTAACACCATTTATCCTTAAACCATCATAATCCTGTTCTTGAAGTTATACGTTG
rJMFF028O12+ TTTTCCTTAACACCATTTATCCTTAAACCATCATAATCCTGTTCTTGAAGTTATACGTTG
rJMFF008O11+ TTTTCCTTAACACCATTTATCCTTAAACCATCATAATCCTGTTCTTGAAGTTATACGTTG
rJMFF041L16+ TTTTCCTTAACACCATTTATCCTTAAACCATCATAATCCTGTTCTTGAAGTTATACGTTG
                      ____________________________________________________________
consensus TTTTCCTTAACACCATTTATCCTTAAACCATCATAATCCTGTTCTTGAAGTTATACGTTG
 
. : . : . : . : . : . :
rJMFF029C01+ TAATGATTAGTTTTG-CATAATTCTTTGGATTAA
rJMFF017F16+ TAATGATTAGTTTTG-CATAATTCTTTGGATTAATGAATCATT
rJMSF033L13+ TAATGATTAGTTT
rJMFF023A11+ TAATGATTAGTTTTG-CATAATTCTTTGGATTAATGAATCATT
rJMFF040K21+ TAATGATTAGTTTT
rJMFF028O12+ TAATGATTAGTTTTGCCATAATTCTTTGGATTAA
rJMFF008O11+ TAATGATTAGTTTTG-CATAATTCTTTGGATTAATGAATCATT
rJMFF041L16+ TAATGATTAGTTTTG-CATAATTCTTTGGATTAATGAATCATTCTGAGTTTTTCGTGACT
                      ____________________________________________________________
consensus TAATGATTAGTTTTG-CATAATTCTTTGGATTAATGAATCATTCTGAGTTTTTCGTGACT