Previous Contig 010156:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009N12Sequence564010156 (8)gb:AB030295_15185053e-83Vigna unguiculata CpABA1 mRNA, complete cds.781010156 (8)sp|Q40412|ABA2_NICPL1e-78Zeaxanthin epoxidase, chloroplast precursor (EC 1.14.-.-).>pir|S69548|S69548 zea
JMFF017L03Sequence577010156 (8)gb:AB030295_15185052e-83Vigna unguiculata CpABA1 mRNA, complete cds.752010156 (8)sp|Q40412|ABA2_NICPL6e-73Zeaxanthin epoxidase, chloroplast precursor (EC 1.14.-.-).>pir|S69548|S69548 zea
JMFF035E12Sequence541014770sp|P93236|ABA2_LYCES2e-92Zeaxanthin epoxidase, chloroplast precursor (EC 1.14.-.-).>pir|T07754|T07754 zea634010156 (8)sp|Q40412|ABA2_NICPL1e-48Zeaxanthin epoxidase, chloroplast precursor (EC 1.14.-.-).>pir|S69548|S69548 zea
JMFF041L08Sequence655003477 (6)gb:BT003850_16369787e-54Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A542010156 (8)sp|Q40412|ABA2_NICPL2e-35Zeaxanthin epoxidase, chloroplast precursor (EC 1.14.-.-).>pir|S69548|S69548 zea
JMSF049D03Sequence620010156 (8)sp|Q40412|ABA2_NICPL1e-86Zeaxanthin epoxidase, chloroplast precursor (EC 1.14.-.-).>pir|S69548|S69548 zea727010156 (8)sp|Q40412|ABA2_NICPL3e-77Zeaxanthin epoxidase, chloroplast precursor (EC 1.14.-.-).>pir|S69548|S69548 zea

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF009N12- GTCGTG
JMFF017L03- GTCGTG
                      ____________________________________________________________
consensus GTCGTG
 
. : . : . : . : . : . :
JMFF009N12- TTACCTTACTCGGGGATTCGATCCATGCTATGCAGCCAAATTTGGGTCAAGGGGGATGCA
JMFF017L03- TTGCCTTACTCGGGGATTCGATCCATGCTATGCAGCCAAATTTGGGTCAAGGGGGATGCA
                      ____________________________________________________________
consensus TTGCCTTACTCGGGGATTCGATCCATGCTATGCAGCCAAATTTGGGTCAAGGGGGATGCA
 
. : . : . : . : . : . :
JMFF009N12- TGGCCATAGAGGATGGGTATCAACTAGCTCTTGAGCTTGACAAAGCTTGGAGGCAAAGTG
JMFF017L03- TGGCCATAGAGGATGGGTATCAACTAGCTCTTGAGCTTGACAAAGCTTGGAGGCAAAGTG
                      ____________________________________________________________
consensus TGGCCATAGAGGATGGGTATCAACTAGCTCTTGAGCTTGACAAAGCTTGGAGGCAAAGTG
 
. : . : . : . : . : . :
JMFF009N12- TCGAGTCGGGAGCCCCTATAGATATCACATCTTCGTTAAAAAGTTACGAGAAAGAGAGAA
JMFF017L03- TCGAGTCGGGAGCCCCTATAGATATCACATCTTCGTTAAAAAGTTACGAGAAAGAGAGAA
                      ____________________________________________________________
consensus TCGAGTCGGGAGCCCCTATAGATATCACATCTTCGTTAAAAAGTTACGAGAAAGAGAGAA
 
. : . : . : . : . : . :
JMFF009N12- GACTGAGAGTCGGAATCATCCACGGGCTGGCCCGAATGGCTGCATTGATGGCAGCAACTT
JMFF017L03- GACTGAGAGTCGGAATCATCCACGGGCTGGCCCGAATGGCTGCATTGATGGCAGCAACTT
JMSF049D03- GCTGGCCCGAATGGCTGCATTGATGGCAGCAACTT
                      ____________________________________________________________
consensus GACTGAGAGTCGGAATCATCCACGGGCTGGCCCGAATGGCTGCATTGATGGCAGCAACTT
 
. : . : . : . : . : . :
JMFF009N12- ATAAGGCATATTTAGGCGTAGGACTCGGTCCATTATCGTTCTTAACCCAATTTAGGATAC
JMFF017L03- ATAAGGCATATTTAGGCGTAGGACTCGGTCCATTATCGTTCTTAACCCAATTTAGGATAC
JMSF049D03- ATAAGGCATATTTAGGCGTAGGACTCGGTCCATTATCGTTCTTAACCCAATTTAGGATAC
rJMSF049D03+ TAGGATAC
rJMFF009N12+ TAACCCAATTTAGGATAC
                      ____________________________________________________________
consensus ATAAGGCATATTTAGGCGTAGGACTCGGTCCATTATCGTTCTTAACCCAATTTAGGATAC
 
. : . : . : . : . : . :
JMFF009N12- CACATCCCGGAAGAGTTGGTGGGAGATTTTTTATAGACCTCGCGATGCCTTTAATGCTTA
JMFF017L03- CACATCCCGGAAGAGTTGGTGGGAGATTTTTTATAGACCTCGCGATGCCTTTAATGCTTA
JMSF049D03- CACATCCCGGAAGAGTTGGTGGGAGATTTTTTATAGACCTCGCGATGCCTTTAATGCTTA
rJMFF017L03+ AGAGTTGGTGGGAGATTTTTTATAGACCTCGCGATGCCTTTAATGCTTA
rJMSF049D03+ CACATCCCGGAAGAGTTGGTGGGAGATTTTTTATAGACCTCGCGATGCCTTTAATGCTTA
rJMFF009N12+ CACATCCCGGAAGAGTTGGTGGGAGATTTTTTATAGACCTCGCGATGCCTTTAATGCTTA
                      ____________________________________________________________
consensus CACATCCCGGAAGAGTTGGTGGGAGATTTTTTATAGACCTCGCGATGCCTTTAATGCTTA
 
. : . : . : . : . : . :
JMFF009N12- GTTGGGTCCTAGGAGGCAATGGAGAAAAACTTGAAGGCAGGCCGAAGCAGTGCAGATTGT
JMFF017L03- GTTGGGTCCTAGGAGGCAATGGAGAAAAACTTGAAGGCAGGCCGAAGCAGTGCAGATTGT
JMSF049D03- GTTGGGTCCTAGGAGGCAATGGAGAAAAACTTGAAGGCAGGCCGAAGCAGTGCAGATTGT
rJMFF017L03+ GTTGGGTCCTAGGAGGCAATGGAGAAAAACTTGAAGGCAGGCCGAAGCAGTGCAGATTGT
rJMSF049D03+ GTTGGGTCCTAGGAGGCAATGGAGAAAAACTTGAAGGCAGGCCGAAGCAGTGCAGATTGT
rJMFF009N12+ GTTGGGTCCTAGGAGGCAATGGAGAAAAACTTGAAGGCAGGCCGAAGCAGTGCAGATTGT
                      ____________________________________________________________
consensus GTTGGGTCCTAGGAGGCAATGGAGAAAAACTTGAAGGCAGGCCGAAGCAGTGCAGATTGT
 
. : . : . : . : . : . :
JMFF009N12- CTGATAAGGCTAATGATCAGCTGCGG-AAATGGTTTGACGATGACGATGCATTGGAGCGT
JMFF017L03- CTGATAAGGCTAATGATCAGCTGCGG-AAATGGTTTGACGATGACGATGCATTGGAGCGT
JMSF049D03- CTGATAAGGCTAATGATCAGCTGCGG-AAATGGTTTGACGATGACGATGCATTGGAGCGT
rJMFF017L03+ CTGATAAGGCTAATGATCAGCTGCGG-AAATGGTTTGACGATGACGATGCATTGGAGCGT
rJMSF049D03+ CTGATAAGGCTAATGATCAGCTGCGG-AAATGGTTTGACGATGACGATGCATTGGAGCGT
rJMFF035E12+ TAATGATCAGCTGCGGAAAATGGTTTGACGATGACGATGCATTGGAGCGT
rJMFF009N12+ CTGATAAGGCTAATGATCAGCTGCGG-AAATGGTTTGACGATGACGATGCATTGGAGCGT
                      ____________________________________________________________
consensus CTGATAAGGCTAATGATCAGCTGCGG-AAATGGTTTGACGATGACGATGCATTGGAGCGT
 
. : . : . : . : . : . :
JMFF009N12- GCCATGAATGGAGAATGGTTTTTATCTCCACTCAAGAATGCAACAAGTACTGCTTCAGAA
JMFF017L03- GCCATGAATGGAGAATGGTTTTTATCTCCACTCAAGAATGCAACAAGTACTGCTTCAGAA
JMSF049D03- GCCATGAATGGAGAATGGTTTTTATCTCCACTCAAGAATGCAACAAGTACTGCTTCAGAA
rJMFF017L03+ GCCATGAATGGAGAATGGTTTTTATCTCCACTCAAGAATGCAACAAGTACTGCTTCAGAA
rJMSF049D03+ GCCATGAATGGAGAATGGTTTTTATCTCCACTCAAGAATGCAACAAGTACTGCTTCAGAA
rJMFF035E12+ GCCATGAATGGAGAATGGTTTTTATCTCCACTCAAGAATGCAACAAGTACTGCTTCAGAA
rJMFF009N12+ GCCATGAATGGAGAATGGTTTTTATCTCCACTCAAGAATGCAACAAGTACTGCTTCAGAA
rJMFF041L08+ AA
                      ____________________________________________________________
consensus GCCATGAATGGAGAATGGTTTTTATCTCCACTCAAGAATGCAACAAGTACTGCTTCAGAA
 
. : . : . : . : . : . :
JMFF009N12- CCCATTTTGTTACGCAGAG
JMFF017L03- CCCATTTTGTTACGCAGAGACGAAAAAACGCC
JMSF049D03- CCCATTTTGTTACGCAGAGACGAAAAAACGCCCTGCATAGTTGGGTCTGTGCCACATCCA
rJMFF017L03+ CCCATTTTGTTACGCAGAGACGAAAAAACGCCCTGCATAGTTGGGTCTGTGCCACATCCA
rJMSF049D03+ CCCATTTTGTTACGCAGAGACGAAAAAACGCCCTGCATAGTTGGGTCTGTGCCACATCCA
rJMFF035E12+ CCCATTTTGTTACGCAGAGACGAAAAAACGCCCTGCATAGTTGGGTCTGTGCCACATCCA
rJMFF009N12+ CCCATTTTGTTACGCAGAGACGAAAAAACGCCCTGCATAGTTGGGTCTGTGCCACATCCA
rJMFF041L08+ CCCATTTTGTTACGCAGAGACGAAAAAACGCCCTGCATAGTTGGGTTTGTGCCACATCCA
                      ____________________________________________________________
consensus CCCATTTTGTTACGCAGAGACGAAAAAACGCCCTGCATAGTTGGGTCTGTGCCACATCCA
 
. : . : . : . : . : . :
JMSF049D03- AACTTCCCGGGAACATCAGTAGTCGTGTCTTCACCCGAGGTGTCCGAACTGCATGCTCGA
rJMFF017L03+ AACTTCCCGGGAACATCAGTAGTCGTGTCTTCACCCGAGGTGTCCGAACTGCATGCTCGA
rJMSF049D03+ AACTTCCCGGGAACATCAGTAGTCGTGTCTTCACCCGAGGTGTCCGAACTGCATGCTCGA
rJMFF035E12+ AACTTCCCGGGAACATCAGTAGTCGTGTCTTCACCCGAGGTGTCCGAACTGCATGCTCGA
rJMFF009N12+ AACTTCCCGGGAACATCAGTAGTCGTGTCTTCACCCGAGGTGTCCGAACTGCATGCTCGA
rJMFF041L08+ AACTTCCCGGGAACATCAGTAGTGGTGTCTTCACCCGAGGTGTCCGAACTGCATGCTCGA
                      ____________________________________________________________
consensus AACTTCCCGGGAACATCAGTAGTCGTGTCTTCACCCGAGGTGTCCGAACTGCATGCTCGA
 
. : . : . : . : . : . :
JMSF049D03- ATAAGCTATAAAGATGGCGCTTTCTTCGTGACTGATTTGCGTAGTAAACATGGTACTTGG
rJMFF017L03+ ATAAGCTATAAAGATGGCGCTTTCTTCGTGACTGATTTGCGTAGTAAACATGGTACTTGG
rJMSF049D03+ ATAAGCTATAAAGATGGCGCTTTCTTCGTGACTGATTTGCGTAGTAAACATGGTACTTGG
rJMFF035E12+ ATAAGCTATAAAGATGGCGCTTTCTTCGTGACTGATTTGCGTAGTAAACATGGTACTTGG
rJMFF009N12+ ATAAGCTATAAAGATGGCGCTTTCTTCGTGACTGATTTGCGTAGTAAACATGGTACTTGG
rJMFF041L08+ ATAAGCTATAAAAATGGCGCTTTTTTCGTGACTGATTTGGGTAGTAAACATGGTACTTGG
                      ____________________________________________________________
consensus ATAAGCTATAAAGATGGCGCTTTCTTCGTGACTGATTTGCGTAGTAAACATGGTACTTGG
 
. : . : . : . : . : . :
JMSF049D03- ATCACCGACNACGAGGGCAGACGCTATCGGGTGTCCCCGAACTTTCCAACCCGTTTTCAT
rJMFF017L03+ ATCACCGACAACGAGGGCAGGCGCTATCGGGTGTCCCCGAACTTTCCAACCCGTTTTCAT
rJMSF049D03+ ATCACCGACAACGAGGGCAGACGCTATCGGGTGTCCCCGAACTTTCCAACCCGTTTTCAT
rJMFF035E12+ ATCACCGACAACGAGGGCAGGCGCTATCGGGTGTCCCCGAACTTTCCAACCCGTTTTCAT
rJMFF009N12+ ATCACCGACAACGAGGGCAGGCGCTATCGGGTGTCCCCGAACTTTCCAACCCGTTTTCAT
rJMFF041L08+ ATCCCCGACAACGAGGGCAGGCGCTATCGGGGGTCCCCGAACTTTCCAACCCGTTTTCAT
                      ____________________________________________________________
consensus ATCACCGACAACGAGGGCAGGCGCTATCGGGTGTCCCCGAACTTTCCAACCCGTTTTCAT
 
. : . : . : . : . : . :
JMSF049D03- CCTTCAGACATCGTCGAATTCGGGTCTGATCGCAAGGCGGCCTTCC
rJMFF017L03+ CCTTCAGACATCGTCGAATTCGGGTCTGATCGCAAGGCGGCNTTCCACGTGAAGGTGAAG
rJMSF049D03+ CCTTCAGACATCGTCGAATTCGGGTCTGATCGCAAGGCGGCCTTCCACGTGAAGGTGAAG
rJMFF035E12+ CCTTCAGACATCGTCGAATTCGGGTCTGATCGCAAGGCGGCCTTCCACGTGAAGGTGAAG
rJMFF009N12+ CCTTCAGACATCGTCGAATTCGGGTCTGATCGCAAGGCGGCCTTCCACGTGAAGGTGAAG
rJMFF041L08+ CCTTCAGACATCGTGGAATTCGGGTTTGATCGCAAGGCGGCCTTCCACGTGAAGGTGAAG
                      ____________________________________________________________
consensus CCTTCAGACATCGTCGAATTCGGGTCTGATCGCAAGGCGGCCTTCCACGTGAAGGTGAAG
 
. : . : . : . : . : . :
rJMFF017L03+ GTGATGAAATTTCCGCCATTTTCCGGCGGGAAGGGAGAGATGGAAGTTTTGCAGGCAGCG
rJMSF049D03+ GTGATGAAATTTCCGCCATTTTCCGGCGGGAAGGGAGAGATGGAAGTTTTGCAGGCAGCG
rJMFF035E12+ GTGATGAAATTTCCGCCATTTTCCGGCGGGAAGGGAGAGATGGAAGTTTTGCAGGCAGCG
rJMFF009N12+ GTGATGAAATTTCCGCCATTTTCCGGCGGGAAGGGAGAGATGGAAGTTTTGCAGGCAGCG
rJMFF041L08+ GTGATGAAATTTCCGCCATTTTCCGGCGGGAAGGGAAAAATGGAAGTTTTGCAGGCAGGG
                      ____________________________________________________________
consensus GTGATGAAATTTCCGCCATTTTCCGGCGGGAAGGGAGAGATGGAAGTTTTGCAGGCAGCG
 
. : . : . : . : . : . :
rJMFF017L03+ TAGGCATTCTCAAGAAAACCGAATTGGTCTAATATGCGAAGAAACACATAGAAATTGTAC
rJMSF049D03+ TAGGCATTCTCAAGAAAACCGAATTGGTCTAATATGCGAAGAAACACATAGAAATTGTAC
rJMFF035E12+ TAGGCATTCTCAAGAAAACCGAATTGGTCTAATATGCGAAGAAACACATAGAAATTGTAC
rJMFF009N12+ TAGGCATTCTCAAGAAAACCGAATTGGTCTAATATGCGAAGAAACACATAGAAATTGTAC
rJMFF041L08+ TAGGCATTTTCAAAAAAACCGAATTGGTTTAATATGCGAAGAAACCCATAGAAATTGTAC
                      ____________________________________________________________
consensus TAGGCATTCTCAAGAAAACCGAATTGGTCTAATATGCGAAGAAACACATAGAAATTGTAC
 
. : . : . : . : . : . :
rJMFF017L03+ AGGATTTATCCATGGCAGCTGAGCCCTGTAAAGCTGCTGCATTTTGTACCATGTATAGAT
rJMSF049D03+ AGGATTTATCCATGGCAGCTGAGCCCTGTAAAGCTGCTGCATTTTGTACCATGTATAGAT
rJMFF035E12+ AGGATTTATCCATGGCAGCTGAGCCCTGTAAAGCTGCTGCATTTTGTACCATGTATAGAT
rJMFF009N12+ AGGATTTATCCATGGCAGCTGAGCCCTGTAAAGCTGCTGCATTTTGTACCATGTATAGAT
rJMFF041L08+ AGGATTTATCCATGGCAGCTGAGCCCTGTAAAGCTGCTGCATTTTGTACCATGTATAGAT
                      ____________________________________________________________
consensus AGGATTTATCCATGGCAGCTGAGCCCTGTAAAGCTGCTGCATTTTGTACCATGTATAGAT
 
. : . : . : . : . : . :
rJMFF017L03+ TTACTGTAATTCAGAACAAGAAATCACTAGAAATGCGAAAGTTA
rJMFF035E12+ TTACTGTAATTCAGAACAAGAAATCACTAGAAATGCGAAAGTTA
rJMFF009N12+ TTACTGTAATTCAGAACAAGAAATCACTAGAAATGCGAAAGTTA
rJMFF041L08+ TTACTGTAATTCAGAACAAGAAATCCCTAGAAATGCGAAAGTTATTACAACAGATTCCCT
                      ____________________________________________________________
consensus TTACTGTAATTCAGAACAAGAAATCACTAGAAATGCGAAAGTTATTACAACAGATTCCCT