Previous Contig 010153:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005F12Sequence259001718 (4)gb:AC145811_17445090.004Oryza sativa chromosome 3 BAC OSJNBb0088L13 genomic sequence, complete sequence.728010153 (4)gb:AC145811_17445094e-51Oryza sativa chromosome 3 BAC OSJNBb0088L13 genomic sequence, complete sequence.
JMFF040B07Sequence446001718 (4)gb:AC145811_17445091e-06Oryza sativa chromosome 3 BAC OSJNBb0088L13 genomic sequence, complete sequence.563010153 (4)gb:AC145811_17445091e-19Oryza sativa chromosome 3 BAC OSJNBb0088L13 genomic sequence, complete sequence.
JMFF041K20Sequence643001718 (4)gb:AC145811_17445093e-40Oryza sativa chromosome 3 BAC OSJNBb0088L13 genomic sequence, complete sequence.516010153 (4)gb:AC145811_17445094e-05Oryza sativa chromosome 3 BAC OSJNBb0088L13 genomic sequence, complete sequence.
JMSF044B19Sequence723001718 (4)gb:AC145811_17445093e-48Oryza sativa chromosome 3 BAC OSJNBb0088L13 genomic sequence, complete sequence.671010153 (4)gb:AC145811_17445095e-42Oryza sativa chromosome 3 BAC OSJNBb0088L13 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF005F12+ AGNTCAGTTTCGATGAGTTCCGGGTCGGGTCACAATTTTTCGTCT
                      ____________________________________________________________
consensus AGNTCAGTTTCGATGAGTTCCGGGTCGGGTCACAATTTTTCGTCT
 
. : . : . : . : . : . :
rJMSF044B19+ CGGAAGGATTCCTTGCTGGTGATCAAAAGATCGGAAGCTCTGGCGCAAATTCCGC
rJMFF005F12+ TGACCCGGAAGGATTCCTTGCTGGTGATC-AAAGATCGGAAGCTCTGGCGCAAATTCCGC
                      ____________________________________________________________
consensus TGACCCGGAAGGATTCCTTGCTGGTGATCAAAAGATCGGAAGCTCTGGCGCAAATTCCGC
 
. : . : . : . : . : . :
rJMSF044B19+ AAGCCTTGCATAAACGTCGAATCCTGCTACCCCGAAGAGCACTACTTCCCCACCCTGATT
rJMFF005F12+ AAGCCTTGCATAAACGTCGAATCCTGCTACCCCGAAGAGCACTACTTCCCCACCCTGATT
                      ____________________________________________________________
consensus AAGCCTTGCATAAACGTCGAATCCTGCTACCCCGAAGAGCACTACTTCCCCACCCTGATT
 
. : . : . : . : . : . :
rJMSF044B19+ TCAATGCAGGACCCGAAAGGCTCCGCGGGTTACACATTGACCCGGGTTAATTGGACCGAC
rJMFF005F12+ TCAATGCAGGACCCGAAAGGCTCCGCGGGTTACACATTGACCCGGGTTAATTGGACCGAC
rJMFF040B07+ TGGACCGAC
                      ____________________________________________________________
consensus TCAATGCAGGACCCGAAAGGCTCCGCGGGTTACACATTGACCCGGGTTAATTGGACCGAC
 
. : . : . : . : . : . :
rJMSF044B19+ ATGGTGGACGGCCACCCCCATACCTACCACCCGCCGGAGATTTCGTCGGAGCTTATTTAC
rJMFF005F12+ ATGGTGGACGGCCACCCCCATACCTACCACCCGCCGGATATTTCGTCGGAGCTTATTTAC
rJMFF040B07+ ATGGTGGACGGCCACCCCCATACNTACCACCCGCCGGAGATTTCGTCGGAGCTTATTTAC
                      ____________________________________________________________
consensus ATGGTGGACGGCCACCCCCATACCTACCACCCGCCGGAGATTTCGTCGGAGCTTATTTAC
 
. : . : . : . : . : . :
rJMSF044B19+ ACCCTCCGGAAATCGAATTCGACGTATTCTTACATGTTCGCCCGCAAATTCTCCCCCGAT
rJMFF005F12+ ACCCTCCGGAAATCGAATTCGACGTATTCTTACATGTTCGCCCGCAAATTCTCCCCCGAT
rJMFF040B07+ ACCCTCCGGAAATCGAATTCGACGTATTCTTACATGTTCGCCCGCAAATTCTCCCCCGAT
rJMFF041K20+ TATTTTTACATGTTCGCCCGCAAATTCTCCCCCGAT
                      ____________________________________________________________
consensus ACCCTCCGGAAATCGAATTCGACGTATTCTTACATGTTCGCCCGCAAATTCTCCCCCGAT
 
. : . : . : . : . : . :
rJMSF044B19+ TGCCTCAATCCCCTGTTGGAAATGGCGGATTCAGTCATCTTCAAAGATTAGATTTCTATT
rJMFF005F12+ TGCCTCAATCCCCTGTTGGAAATGGCGGATTCAGTCATCTTCAAAGATTAGATTTCTATT
rJMFF040B07+ TGCCTCAATCCCCTGTTGGAAATGGCGGATTCAGTCATCTTCAAAGATTAGATTTCTATT
rJMFF041K20+ TGCCTCAATCCCCTGTTGGAAATGGCGGATTCAGTCATCTTCAAAGATTAGATTTCTATT
                      ____________________________________________________________
consensus TGCCTCAATCCCCTGTTGGAAATGGCGGATTCAGTCATCTTCAAAGATTAGATTTCTATT
 
. : . : . : . : . : . :
rJMSF044B19+ TTTCCGGTGAGGAGAAAGCAGAGGCAAATTTTTTGAAGACGATTGAGATTTCAGGATGTT
rJMFF005F12+ TTTCCGGTGAGGAGAAAGCAGAGGCAAATTTTTTGAAGACGATTGAGATTTCAGGATGTT
rJMFF040B07+ TTTCCGGTGAGGAGAAAGCAGAGGCAAATTTTTTGAAGACGATTGAGATTTCAGGATGTT
rJMFF041K20+ TTTCCGGTGAGGAGAAAGCAGAGGCAAATTTTTTGAAGACGATTGAGATTTCAGGATGTT
                      ____________________________________________________________
consensus TTTCCGGTGAGGAGAAAGCAGAGGCAAATTTTTTGAAGACGATTGAGATTTCAGGATGTT
 
. : . : . : . : . : . :
rJMSF044B19+ GAAGTAGTAGCACGAGTTGGGGGTACAAGGTTTGATGAGGGTGTTAAGAATAAAGCCCCC
rJMFF005F12+ GAAGTAGTAGCACGAGTTGGGGGTACAAGGTTTGATGAGGGTGTTAAGAATAAAGCCCCC
rJMFF040B07+ GAAGTAGTAGCACGAGTTGGGGGTACAAGGTTTGATGAGGGTGTTAAGAATAAAGCCCCC
rJMFF041K20+ GAAGTAGTAGCACGAGTTGGGGGTACAAGGTTTGATGAGGGTGTTAAGAATAAAGCCCCC
                      ____________________________________________________________
consensus GAAGTAGTAGCACGAGTTGGGGGTACAAGGTTTGATGAGGGTGTTAAGAATAAAGCCCCC
 
. : . : . : . : . : . :
rJMSF044B19+ TCGGCCTAAGTCTCCCCCACCTCCACCTCCGGGAGGATTGTATGTGAAGCCTGGAATAGC
rJMFF005F12+ TCGGCCTAAGTCTCCCCCACCTCCACCTCCGGGAGGATTGTATGTGAAGCCTGGAATAGC
rJMFF040B07+ TCGGCCTAAGTCTCCCCCACCTCCACCTCCGGGAGGATTGTATGTGAAGCCTGGAATAGC
rJMFF041K20+ TCGGCTTAAGTTTCCCCCACCTCCACCTCCGGGAGGATTGTATGTGAAGCCTGGAATAGC
                      ____________________________________________________________
consensus TCGGCCTAAGTCTCCCCCACCTCCACCTCCGGGAGGATTGTATGTGAAGCCTGGAATAGC
 
. : . : . : . : . : . :
rJMSF044B19+ TTTCGAAGAAAGAAAGAAAGAAAGAAAGCTGTGATAGAAGTAGTAGTGAAGAAGCAAGTG
rJMFF005F12+ TTTCGAAGAAAGAAAGAAAGAAAGAAAGCTGTGATAGAAGTAGTAGTGAAGAAGCAAGTG
rJMFF040B07+ TTTCGAAGAAAGAAAGAAAGAAAGAAAGCTGTGATAGAAGTAGTAGTGAAGAAGCAAGTG
rJMFF041K20+ TTTCGAAGAAAGAAAGAAAGAAAGAAAGCTGTGATAGAAGTAGTAGTGAAAAAGCAAGTG
                      ____________________________________________________________
consensus TTTCGAAGAAAGAAAGAAAGAAAGAAAGCTGTGATAGAAGTAGTAGTGAAGAAGCAAGTG
 
. : . : . : . : . : . :
rJMSF044B19+ AAGTGATGTAATGTTTGGATGGTTGTTGATATGGGGGGGTTTTCTTCCCTTGTGTTTTAA
rJMFF005F12+ AAGTGATGTAATGTTTGGATGGTTGTTGATATGGGGGGGTTTTCTTCCCTTGTGTTTTAA
rJMFF040B07+ AAGTGATGTAATGTTTGGATGGTTGTTGATATGGGGGGGTTTTCTTCCCTTGTGTTTTAA
rJMFF041K20+ AAGTGATGTAATGTTTGGATGGTTGTTGATATGGGGGGGTTTTCTTCCCTTGTGTTTTAA
                      ____________________________________________________________
consensus AAGTGATGTAATGTTTGGATGGTTGTTGATATGGGGGGGTTTTCTTCCCTTGTGTTTTAA
 
. : . : . : . : . : . :
rJMSF044B19+ TTCTGT
rJMFF005F12+ TTCTGTTTACATATTTGGTGGATC
rJMFF040B07+ TTCTGTGTACATATTTGGTGGATCATGAATGGGAAGATGATTTGTTTATATACCC
rJMFF041K20+ TTCTGTGTACATATTTGGTGGATCATGAATGGGAAGATGATTTGTTTATATACCCCXXXX
                      ____________________________________________________________
consensus TTCTGTGTACATATTTGGTGGATCATGAATGGGAAGATGATTTGTTTATATACCCCNNNN
 
. : . : . : . : . : . :
rJMFF041K20+ XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTAAAAAAAAAAAAAAACTCTCCAGGGTG
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAAAAAAAAAAAAACTCTCCAGGGTG