Previous Contig 010152:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041K14Sequence644010152 (4)gb:AY059833_15646771e-67Arabidopsis thaliana formyltetrahydrofolate deformylase-like (MNJ7.1) mRNA, comp363010152 (4)gb:AY059833_15646775e-05Arabidopsis thaliana formyltetrahydrofolate deformylase-like (MNJ7.1) mRNA, comp
JMSF024E02Sequence709010152 (4)gb:AY059833_15646772e-82Arabidopsis thaliana formyltetrahydrofolate deformylase-like (MNJ7.1) mRNA, comp767010152 (4)gb:AY059833_15646771e-69Arabidopsis thaliana formyltetrahydrofolate deformylase-like (MNJ7.1) mRNA, comp

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF041K14- GTTAAGAGAAA
                      ____________________________________________________________
consensus GTTAAGAGAAA
 
. : . : . : . : . : . :
JMFF041K14- AAACTGGAAAAATTATACACTCACATCTCCCGTGAGGGAGGAGGCGTATAAATGAGCCTC
JMSF024E02- ATCTCCCGTGAGGGAGGAGGCGTAGAAATGAGCCTC
                      ____________________________________________________________
consensus AAACTGGAAAAATTATACACTCACATCTCCCGTGAGGGAGGAGGCGTATAAATGAGCCTC
 
. : . : . : . : . : . :
JMFF041K14- CCCCTCCTCCTCCGCAGAGCGGTATTCTCTTCCGGCCTACCTCCCAAAGTTTTTGGGTTT
JMSF024E02- CCCCTCCTCCTCCGCAGAGCGGTATTCTCTTCCGGCCTACCTCCCAAAGTTTTTGGGTTT
                      ____________________________________________________________
consensus CCCCTCCTCCTCCGCAGAGCGGTATTCTCTTCCGGCCTACCTCCCAAAGTTTTTGGGTTT
 
. : . : . : . : . : . :
JMFF041K14- ACAAATCGGCCGTTCGGATCTCTGAATGTCGCCGGCGAGTCCCTCGACTGCTCCACCTCT
JMSF024E02- ACAAATCGGCCGTTCGGATCTCTGAATGTCGCCGGCGAGTCCCTCGACTGCTCCACCTCT
                      ____________________________________________________________
consensus ACAAATCGGCCGTTCGGATCTCTGAATGTCGCCGGCGAGTCCCTCGACTGCTCCACCTCT
 
. : . : . : . : . : . :
JMFF041K14- CCTTCCCTCATCCATGGAATTCACGTTTTCCACTGCCCCGATGAAGTGGGGATAGTTGCA
JMSF024E02- CCTTCCCTCATCCATGGAATTCACGTTTTCCACTGCCCCGATGAAGTGGGGATAGTTGCA
                      ____________________________________________________________
consensus CCTTCCCTCATCCATGGAATTCACGTTTTCCACTGCCCCGATGAAGTGGGGATAGTTGCA
 
. : . : . : . : . : . :
JMFF041K14- AAGCTATCGGATTGCATTGCTTCCAGGGGTGGAAATATCCTCAATGCTGATGTCTTCGTG
JMSF024E02- AAGCTATCGGATTGCATTGCTTCCAGGGGTGGAAATATCCTCAATGCTGATGTCTTCGTG
                      ____________________________________________________________
consensus AAGCTATCGGATTGCATTGCTTCCAGGGGTGGAAATATCCTCAATGCTGATGTCTTCGTG
 
. : . : . : . : . : . :
JMFF041K14- CCGGAAGATAAGCATGTCTTTTACTCAAGAAGTGAATTTGTGTTTAATCCTGCTAAATGG
JMSF024E02- CCGGAAGATAAGCATGTCTTTTACTCAAGAAGTGAATTTGTGTTTAATCCTGCTAAATGG
                      ____________________________________________________________
consensus CCGGAAGATAAGCATGTCTTTTACTCAAGAAGTGAATTTGTGTTTAATCCTGCTAAATGG
 
. : . : . : . : . : . :
JMFF041K14- CCACGAGGCCAAATGGATGTGGACTTCCTAAAGCTATCAAAGATGTTTAATGCAATGACG
JMSF024E02- CCACGAGGCCAAATGGATGTGGACTTCCTAAAGCTATCAAAGATGTTTAATGCAATGACG
                      ____________________________________________________________
consensus CCACGAGGCCAAATGGATGTGGACTTCCTAAAGCTATCAAAGATGTTTAATGCAATGACG
 
. : . : . : . : . : . :
JMFF041K14- TCTGTCGTTCGAGTGCCTACTATGGATCCAAAGTATAAGATTGCTGTTCTTGCATCAAAG
JMSF024E02- TCTGTCGTTCGAGTGCCTACTATGGATCCAAAGTATAAGATTGCTGTTCTTGCATCAAAG
                      ____________________________________________________________
consensus TCTGTCGTTCGAGTGCCTACTATGGATCCAAAGTATAAGATTGCTGTTCTTGCATCAAAG
 
. : . : . : . : . : . :
JMFF041K14- CAGGACCACTGTCTTGTAGATTTACTGCATGGGTGGCAGGATGGAAGGCTTCCTGTTCAA
JMSF024E02- CAGGACCACTGTCTTGTAGATTTACTGCATGGGTGGCAGGATGGAAGGCTTCCTGTTCAA
                      ____________________________________________________________
consensus CAGGACCACTGTCTTGTAGATTTACTGCATGGGTGGCAGGATGGAAGGCTTCCTGTTCAA
 
. : . : . : . : . : . :
JMFF041K14- ATAACTTGTGTAATTAGTAATCATGATAGAAGTTCAAACACCCATGTGATTCGATTTCTT
JMSF024E02- ATAACTTGTGTAATTAGTAATCATGATAGAAGTTCAAACACCCATGTGATTCGATTTCTT
rJMSF024E02+ AATTAGTAATCNTGATAGGAGTTCAAACACCCATGTGATTCGATTTCTT
                      ____________________________________________________________
consensus ATAACTTGTGTAATTAGTAATCATGATAGAAGTTCAAACACCCATGTGATTCGATTTCTT
 
. : . : . : . : . : . :
JMFF041K14- GAAAGACATGGAATTCCATATCATTACTTGCAT
JMSF024E02- GAAAGACATGGAATTCCATATCATTACTTGCATACCGGTAATGATAATAAAAGAGAAGGA
rJMSF024E02+ GAAAGACATGGAATTCCATATCATTACTTGCATACCGGTAATGATAATAAAAGAGAAGGA
                      ____________________________________________________________
consensus GAAAGACATGGAATTCCATATCATTACTTGCATACCGGTAATGATAATAAAAGAGAAGGA
 
. : . : . : . : . : . :
JMSF024E02- GAGATCTTGGAATTAGTTCAGGACACTGACTTTTTAGTCCTTGCAAGATACATGCAGATA
rJMSF024E02+ GAGATCTTGGAATTAGTTCAGGACACTGACTTTTTAGTCCTTGCAAGATACATGCAGATA
                      ____________________________________________________________
consensus GAGATCTTGGAATTAGTTCAGGACACTGACTTTTTAGTCCTTGCAAGATACATGCAGATA
 
. : . : . : . : . : . :
JMSF024E02- CTGTCTGGAGAC
rJMSF024E02+ CTGTCTGGAGACTTTTTGAGCAAATATAAGAAAGACATTATAAACATTCATCATGGCCTG
                      ____________________________________________________________
consensus CTGTCTGGAGACTTTTTGAGCAAATATAAGAAAGACATTATAAACATTCATCATGGCCTG
 
. : . : . : . : . : . :
rJMSF024E02+ CTTCCATCATTTAAGGGTGGGAAGCCAGCTAGGCAGGCCTTTGATGCTGGTGTTAAATTG
                      ____________________________________________________________
consensus CTTCCATCATTTAAGGGTGGGAAGCCAGCTAGGCAGGCCTTTGATGCTGGTGTTAAATTG
 
. : . : . : . : . : . :
rJMSF024E02+ ATTGGTGCAACAACTCACTTTGTCTCTGAAGAACTTGATTGTGGGCCAATCATTGAACAG
                      ____________________________________________________________
consensus ATTGGTGCAACAACTCACTTTGTCTCTGAAGAACTTGATTGTGGGCCAATCATTGAACAG
 
. : . : . : . : . : . :
rJMSF024E02+ ATGGTGAATTTGCATGGTATGGCAATTATATAGGGCTTTTTATATCATTCCAGGTTGAAA
                      ____________________________________________________________
consensus ATGGTGAATTTGCATGGTATGGCAATTATATAGGGCTTTTTATATCATTCCAGGTTGAAA
 
. : . : . : . : . : . :
rJMSF024E02+ GAGTTTCCCATAGAGACAATCTGCGGAGTTTTGTACAGAGGTCTGAGGAACTTGAGAAAC
rJMFF041K14+ AAC
                      ____________________________________________________________
consensus GAGTTTCCCATAGAGACAATCTGCGGAGTTTTGTACAGAGGTCTGAGGAACTTGAGAAAC
 
. : . : . : . : . : . :
rJMSF024E02+ GGTGTCTTGCTAAAGCAATAAAGTCATACTGTGAATTGCGTGTTTTACCTTATGAGAGAA
rJMFF041K14+ GGTGTCTTGCTAAAGCAATAAAGTCATACTGTGAATTGCGTGTTTTACCTTATGAGAGAA
                      ____________________________________________________________
consensus GGTGTCTTGCTAAAGCAATAAAGTCATACTGTGAATTGCGTGTTTTACCTTATGAGAGAA
 
. : . : . : . : . : . :
rJMSF024E02+ ACAAGACTGTTGTGTTTTGACAGTGCCAGGAAGAAGGGGAAAGGATAAAAACACAGTTAG
rJMFF041K14+ ACAAGACTGTTGTGTTTTGACAGTGCCAGGAAGAAGGGGAAAGGATAAAAACCCAGTTAG
                      ____________________________________________________________
consensus ACAAGACTGTTGTGTTTTGACAGTGCCAGGAAGAAGGGGAAAGGATAAAAACCCAGTTAG
 
. : . : . : . : . : . :
rJMSF024E02+ TTCAATATTTTAGAAGTTCATGAAATTGAACATACACTAATTCTTACAGATACCTACTGG
rJMFF041K14+ TTCAATATTTTAGAAGTTCATGAAATTGAACATACACTAATTCTTACAGATACCTACTGG
                      ____________________________________________________________
consensus TTCAATATTTTAGAAGTTCATGAAATTGAACATACACTAATTCTTACAGATACCTACTGG
 
. : . : . : . : . : . :
rJMSF024E02+ AAAGTCCACATCTGTGCAGTAAAGATACCAACTCTCACTCCAAAATCAATAATATTTGTA
rJMFF041K14+ AAAGTCCACATCTGTGCAGTAAAGATACCAACTCTCACTCCAAAATCAATAATATTTGTA
                      ____________________________________________________________
consensus AAAGTCCACATCTGTGCAGTAAAGATACCAACTCTCACTCCAAAATCAATAATATTTGTA
 
. : . : . : . : . : . :
rJMSF024E02+ GCCCAATGTTGTATTCTTGGCTTAATTCCTTTTTTACTCAATGCTTCTATAGCTGAAT
rJMFF041K14+ GCCCAATGTTGTATTCTTGGCTTAATTCCTTTTTTACTCAATGCTTCTATAGCTGAATGT
                      ____________________________________________________________
consensus GCCCAATGTTGTATTCTTGGCTTAATTCCTTTTTTACTCAATGCTTCTATAGCTGAATGT
 
. : . : . : . : . : . :
rJMFF041K14+ AAGCATTTTTTAATGTTTCAAGTTTGCTGAATAATCATTTTGATTTTGTGCATTCATTAT
                      ____________________________________________________________
consensus AAGCATTTTTTAATGTTTCAAGTTTGCTGAATAATCATTTTGATTTTGTGCATTCATTAT