Previous Contig 010150:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014L08Sequence522000978 (5)sp|Q40147|GSA_LYCES3e-58Glutamate-1-semialdehyde 2,1-aminomutase, chloroplast precursor (EC 5.4.3.8) (GS618010150 (6)gb:AF366293_17916305e-78Brassica napus glutamate 1-semialdehyde aminotransferase (Gsa) mRNA, complete cd
JMFF016O17Sequence525000978 (5)sp|Q40147|GSA_LYCES4e-58Glutamate-1-semialdehyde 2,1-aminomutase, chloroplast precursor (EC 5.4.3.8) (GS686010150 (6)gb:AF366293_17916306e-78Brassica napus glutamate 1-semialdehyde aminotransferase (Gsa) mRNA, complete cd
JMFF019E17Sequence595000978 (5)sp|Q40147|GSA_LYCES3e-53Glutamate-1-semialdehyde 2,1-aminomutase, chloroplast precursor (EC 5.4.3.8) (GS718010150 (6)gb:AF366293_17916307e-85Brassica napus glutamate 1-semialdehyde aminotransferase (Gsa) mRNA, complete cd
JMFF041K12Sequence632000978 (5)sp|P31593|GSA_TOBAC1e-83Glutamate-1-semialdehyde 2,1-aminomutase, chloroplast precursor (EC 5.4.3.8) (GS624010150 (6)gb:AF366293_17916302e-69Brassica napus glutamate 1-semialdehyde aminotransferase (Gsa) mRNA, complete cd
JMSF018A06Sequence346001047 (5)pir|G84670|G846700.011hypothetical protein At2g27260 [imported] - Arabidopsis thaliana>gb:AC006233_153667010150 (6)gb:AF366293_17916309e-83Brassica napus glutamate 1-semialdehyde aminotransferase (Gsa) mRNA, complete cd
JMSF031O23Sequence649000978 (5)sp|P31593|GSA_TOBAC2e-81Glutamate-1-semialdehyde 2,1-aminomutase, chloroplast precursor (EC 5.4.3.8) (GS650010150 (6)gb:AF366293_17916301e-82Brassica napus glutamate 1-semialdehyde aminotransferase (Gsa) mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF018A06+ GAAGTCATGACT
rJMSF031O23+ GAAGTCATGACT
rJMFF019E17+ CTCNTCATCTTTGACGAAGTCATGACT
                      ____________________________________________________________
consensus CTCNTCATCTTTGACGAAGTCATGACT
 
. : . : . : . : . : . :
rJMSF018A06+ GGATTTCGCCTCTCGTATGGTGGGGCCCAGGAGTATTTTGGCATAACTCCCGATTTGACG
rJMSF031O23+ GGATTTCGCCTCTCGTATNGTGGGGCCCAGGAGTATTTTGGCATAACTCCCGATTTGACG
rJMFF019E17+ GGATTTCGCCTCTCGTATGGTGGGGCCCAGGAGTATTTTGGCATAACTCCCGATTTGACG
rJMFF014L08+ GTATGGTGGGGCCCAGGAGTATTTTGGCATAACTCCCGATTTGACG
rJMFF016O17+ GTATGGTGGGGCCCAGGAGTATTTTGGCATAACTCCCGATTTGACG
                      ____________________________________________________________
consensus GGATTTCGCCTCTCGTATGGTGGGGCCCAGGAGTATTTTGGCATAACTCCCGATTTGACG
 
. : . : . : . : . : . :
rJMSF018A06+ ACGCTCGGGAAGATCATTGGCGGCGGCCTGCCTGTCGGGGCGTACGGCGGGAGGAGGGAT
rJMSF031O23+ ACGCTCGGGAAGATCATTGGCGGCGGCCTGCCTGTCGGGGCGTACGGCGGGAGGAGGGAT
rJMFF019E17+ ACGCTCGGGAAGATCATTGGCGGCGGCCTGCCTGTCGGGGCGTACGGCGGGAGGAGGGAT
rJMFF014L08+ ACGCTCGGGAAGATCATTGGCGGCGGCCTGCCTGTCGGGGCGTACGGCGGGAGGAGGGAT
rJMFF016O17+ ACGCTCGGGAAGATCATTGGCGGCGGCCTGCCTGTCGGGGCGTACGGCGGGAGGAGGGAT
rJMFF041K12+ GGGGCGTACGGCGGGAGGAGGGAT
                      ____________________________________________________________
consensus ACGCTCGGGAAGATCATTGGCGGCGGCCTGCCTGTCGGGGCGTACGGCGGGAGGAGGGAT
 
. : . : . : . : . : . :
rJMSF018A06+ ATTATGGAGATGGTAGCACCTGCTGGACCTATGTATCAGGCCGGGACGTTGAGTGGAAAC
rJMSF031O23+ ATTATGGAGATGGTAGCACCTGCTGGACCTATGTATCAGGCCGGGACGTTGAGTGGAAAC
rJMFF019E17+ ATTATGGAGATGGTAGCACCTGCTGGACCTATGTATCAGGCCGGGACGTTGAGTGGAAAC
rJMFF014L08+ ATTATGGAGATGGTAGCACCTGCTGGACCTATGTATCAGGCCGGGACGTTGAGTGGAAAC
rJMFF016O17+ ATTATGGAGATGGTAGCACCTGCTGGACCTATGTATCAGGCCGGGACGTTGAGTGGAAAC
rJMFF041K12+ ATTATGGAGATGGTAGCACCTGCTGGACCTATGTATCAGGCCGGGACGTTGAGTGGAAAC
                      ____________________________________________________________
consensus ATTATGGAGATGGTAGCACCTGCTGGACCTATGTATCAGGCCGGGACGTTGAGTGGAAAC
 
. : . : . : . : . : . :
rJMSF018A06+ CCGCTAGCAATGACAGCGGGAATCCACACGCTAAAGCGGTTAAAGGAGCCGGGAAGCTAC
rJMSF031O23+ CCGCTAGCAATGACAGCGGGAATCCACACGCTAAAGCGGTTAAAGGAGCCGGGAAGCTAC
rJMFF019E17+ CCGCTAGCAATGACAGCGGGAATCCACACGCTAAAGCGGTTAAAGGAGCCGGGAAGCTAC
rJMFF014L08+ CCGCTAGCAATGACAGCGGGAATCCACACGCTAAAGCGGTTAAAGGAGCCGGGAAGCTAC
rJMFF016O17+ CCGCTAGCAATGACAGCGGGAATCCACACGCTAAAGCGGTTAAAGGAGCCGGGAAGCTAC
rJMFF041K12+ CCGCTAGCAATGACAGCGGGAATCCACACGCTAAAGCGGTTAAAGGAGCCGGGAAGCTAC
                      ____________________________________________________________
consensus CCGCTAGCAATGACAGCGGGAATCCACACGCTAAAGCGGTTAAAGGAGCCGGGAAGCTAC
 
. : . : . : . : . : . :
rJMSF018A06+ GAGTACTTGAAAAACGTCACGAGTGAACTAATCGAGGGCATTGTGGGTGCGGGAAAGAAG
rJMSF031O23+ GAGTACTTGAAAAACGTCACGAGTGAACTAATCGAGGGCATTGTGGGTGCGGGAAAGAAG
rJMFF019E17+ GAGTACTTGAAAAACGTCACGAGTGAACTAATCGAGGGCATTGTGGGTGCGGGAAAGAAG
rJMFF014L08+ GAGTACTTGAAAAACGTCACGAGTGAACTAATCGAGGGCATTGTGGGTGCGGGAAAGAAG
rJMFF016O17+ GAGTACTTGAAAAACGTCACGAGTGAACTAATCGAGGGCATTGTGGGTGCGGGAAAGAAG
rJMFF041K12+ GAGTACTTGAAAAACGTCACGAGTGAACTAATCGAGGGCATTGTGGGTGCGGGAAAGAAG
                      ____________________________________________________________
consensus GAGTACTTGAAAAACGTCACGAGTGAACTAATCGAGGGCATTGTGGGTGCGGGAAAGAAG
 
. : . : . : . : . : . :
rJMSF018A06+ GCTGGTCATGCAATTTCCGGTGGGTATATCAGTGGCATGTTCGGTTTCTTCTTCATGGAT
rJMSF031O23+ GCTGGTCATGCAATTTCCGGTGGGTATATCAGTGGCATGTTCGGTTTCTTCTTCATGGAT
rJMFF019E17+ GCTGGTCATGCAATTTCCGGTGGGTATATCAGTGGCATGTTCGGTTTCTTCTTCATGGAT
rJMFF014L08+ GCTGGTCATGCAATTTCCGGTGGGTATATCAGTGGCATGTTCGGTTTCTTCTTCATGGAT
rJMFF016O17+ GCTGGTCATGCAATTTCCGGTGGGTATATCAGTGGCATGTTCGGTTTCTTCTTCATGGAT
rJMFF041K12+ GCTGGTCATGCAATTTCCGGTGGGTATATCAGTGGCATGTTCGGTTTCTTCTTCATGGAT
                      ____________________________________________________________
consensus GCTGGTCATGCAATTTCCGGTGGGTATATCAGTGGCATGTTCGGTTTCTTCTTCATGGAT
 
. : . : . : . : . : . :
rJMSF018A06+ GGCCCCGTTTACAACTTTGCTGATGCAAAGAAGAGCGACACTGCCAAATTCGCGAGGTTC
rJMSF031O23+ GGCCCCGTTTACAACTTTGCTGATGCAAAGAAGAGCGACACTGCCAAATTCGCGAGGTTC
rJMFF019E17+ GGCCCCGTTTACAACTTTGCTGATGCAAAGAAGAGCGACACTGCCAAATTCGCGAGGTTC
rJMFF014L08+ GGCCCCGTTTACAACTTTGCTGATGCAAAGAAGAGCGACACTGCCAAATTCGCGAGGTTC
rJMFF016O17+ GGCCCCGTTTACAACTTTGCTGATGCAAAGAAGAGCGACACTGCCAAATTCGCGAGGTTC
rJMFF041K12+ GGCCCCGTTTACAACTTTGCTGATGCAAAGAAGAGCGACACTGCCAAATTCGCGAGGTTC
                      ____________________________________________________________
consensus GGCCCCGTTTACAACTTTGCTGATGCAAAGAAGAGCGACACTGCCAAATTCGCGAGGTTC
 
. : . : . : . : . : . :
rJMSF018A06+ TTTAGAGGAATGCTAGAGGAAGGCGTCTATTTCGCGCCTTCCCAGTTCGAAGCTGGATTC
rJMSF031O23+ TTTAGAGGAATGCTAGAGGAAGGCGTCTATTTCGCGCCTTCCCAGTTCGAAGCTGGATTC
rJMFF019E17+ TTTAGAGGAATGCTAGAGGAAGGCGTCTATTTCGCGCCTTCCCAGTTCGAAGCTGGATTC
rJMFF014L08+ TTTAGAGGAATGCTAGAGGAAGGCGTCTATTTCGCGCCTTCCCAGTTCGAAGCTGGATTC
rJMFF016O17+ TTTAGAGGAATGCTAGAGGAAGGCGTCTATTTCGCGCCTTCCCAGTTCGAAGCTGGATTC
rJMFF041K12+ TTTAGAGGAATGCTAGAGGAAGGCGTCTATTTCGCGCCTTCCCAGTTCGAAGCTGGATTC
                      ____________________________________________________________
consensus TTTAGAGGAATGCTAGAGGAAGGCGTCTATTTCGCGCCTTCCCAGTTCGAAGCTGGATTC
 
. : . : . : . : . : . :
rJMSF018A06+ ACGGGCTTAGCGCATACTCCCGAGGATATTCAAAACACGATAGCTGCTGCTGAGAGGGTG
rJMSF031O23+ ACGGGCTTAGCGCATACTCCCGAGGATATTCAAAACACGATAGCTGCTGCTGAGAGGGTG
rJMFF019E17+ ACGGGCTTAGCGCATACTCCCGAGGATATTCAAAACACGATAGCTGCTGCTGAGAGGGTG
rJMFF014L08+ ACGGGCTTAGCGCATACTCCCGAGGATATTCAAAACACGATAGCTGCTGCTGAGAGGGTG
rJMFF016O17+ ACGGGCTTAGCGCATACTCCCGAGGATATTCAAAACACGATAGCTGCTGCTGAGAGGGTG
rJMFF041K12+ ACGGGCTTAGCGCATACTCCCGAGGATATTCAAAACACGATAGCTGCTGCTGAGAGGGTG
                      ____________________________________________________________
consensus ACGGGCTTAGCGCATACTCCCGAGGATATTCAAAACACGATAGCTGCTGCTGAGAGGGTG
 
. : . : . : . : . : . :
rJMSF018A06+ TTCAAGAAACTGTGATATTTATTGATGCCTTTTCTCTTGATCCTTTTTGTTTAGGTAATT
rJMSF031O23+ TTCAAGAAACTGTGATATTTATTGATGCCTTTTCTCTTGATCCTTTTTGTTTAGGTAATT
rJMFF019E17+ TTCAAGAAACTGTGATATTTATTGATGCCTTTTCTCTTGATCCTTTTTTTTTAGGTAATT
rJMFF014L08+ TTCAAGAAACTGTGATATTTATTGATGCCTTTTCTCTTGATCCTTTTTGTTTAGGTAATT
rJMFF016O17+ TTCAAGAAACTGTGATATTTATTGATGCCTTTTCTCTTGATCCTTTTTGTTTAGGTAATT
rJMFF041K12+ TTCAAGAAACTGTGATATTTATTGATGCCTTTTCTCTTGATCCTTTTTGTTTAGGTAATT
                      ____________________________________________________________
consensus TTCAAGAAACTGTGATATTTATTGATGCCTTTTCTCTTGATCCTTTTTGTTTAGGTAATT
 
. : . : . : . : . : . :
rJMSF018A06+ AAGGATTACACTTTTGTAAGACACCTTTGTTTGTTTGTTTGTTTGTT
rJMSF031O23+ AAGGATTACACTTTTGTAAGACACCTT
rJMFF019E17+ AAGGATTACACTTTTGTAAGACACCTTTGTTTGTTTGTTTGTTTGTTTGGAGGGACAGCA
rJMFF014L08+ AAGGATTACACTTTTGTAAGACACCTTTGTTT
rJMFF016O17+ AAGGATTACACTTTTGTAAGACACCTTTGTTTGTTTGTTTGTTTGTTNGGAGGGACAGCA
rJMFF041K12+ AAGGATTACACTTTTGTAAGACACCTTTGTTTGTTTGTTTGTTTGTTTGGAGGGACAGCA
                      ____________________________________________________________
consensus AAGGATTACACTTTTGTAAGACACCTTTGTTTGTTTGTTTGTTTGTTTGGAGGGACAGCA
 
. : . : . : . : . : . :
rJMFF019E17+ TTTTTGTAATCTAGATGCTTGTATCATACCT
rJMFF016O17+ TTTTTGTAATCTAGATGCTTGTATCATACCT
rJMFF041K12+ TTTTTGTAATCTAGATGCTTGTATCATACCTTAATGCTGAAATTGTGGTCTATTTCTTAT
                      ____________________________________________________________
consensus TTTTTGTAATCTAGATGCTTGTATCATACCTTAATGCTGAAATTGTGGTCTATTTCTTAT