Previous Contig 010139:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003M01Sequence275014105sp|O22493|GSH1_LYCES4e-04Glutamate--cysteine ligase, chloroplast precursor (EC 6.3.2.2) (Gamma- glutamylc741010139 (5)gb:AB158510_15284061e-67Zinnia elegans ZeGSH1 mRNA for gamma-glutamylcysteine synthetase, complete cds.
JMFF004P16Sequence515001770 (3)sp|O22493|GSH1_LYCES1e-45Glutamate--cysteine ligase, chloroplast precursor (EC 6.3.2.2) (Gamma- glutamylc737010139 (5)gb:AB158510_15284065e-72Zinnia elegans ZeGSH1 mRNA for gamma-glutamylcysteine synthetase, complete cds.
JMFF021L17Sequence539001770 (3)sp|O22493|GSH1_LYCES4e-50Glutamate--cysteine ligase, chloroplast precursor (EC 6.3.2.2) (Gamma- glutamylc748010139 (5)gb:AB158510_15284063e-68Zinnia elegans ZeGSH1 mRNA for gamma-glutamylcysteine synthetase, complete cds.
JMFF041I07Sequence592001770 (3)sp|O22493|GSH1_LYCES5e-60Glutamate--cysteine ligase, chloroplast precursor (EC 6.3.2.2) (Gamma- glutamylc471010139 (5)sp|O22493|GSH1_LYCES5e-22Glutamate--cysteine ligase, chloroplast precursor (EC 6.3.2.2) (Gamma- glutamylc
JMSF034L03Sequence621019813sp|O22493|GSH1_LYCES2e-40Glutamate--cysteine ligase, chloroplast precursor (EC 6.3.2.2) (Gamma- glutamylc755010139 (5)gb:AB158510_15284061e-92Zinnia elegans ZeGSH1 mRNA for gamma-glutamylcysteine synthetase, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF034L03+ AAGA
                      ____________________________________________________________
consensus AAGA
 
. : . : . : . : . : . :
rJMSF034L03+ AGTATATTGATTGTACTGGAATGTCCTTCAGGGATTTTATGGCGGGGAAACTGCCTCCTA
                      ____________________________________________________________
consensus AGTATATTGATTGTACTGGAATGTCCTTCAGGGATTTTATGGCGGGGAAACTGCCTCCTA
 
. : . : . : . : . : . :
rJMSF034L03+ TTCCTGGAGAATATCCCACACTTAATGACTGGGAGAACCATTTGACAACAATATTT-CCC
rJMFF003M01+ TGGAGAATATCCCACACTTAATGACTGGGAGAACCATTTGACAACAATATTTNCCC
rJMFF021L17+ ACTTAATGACTGGGAGAACCATTTGACAACAATATTTCCCC
rJMFF004P16+ GGAGAACCATTTGACANCAATATTT-CCC
                      ____________________________________________________________
consensus TTCCTGGAGAATATCCCACACTTAATGACTGGGAGAACCATTTGACAACAATATTTCCCC
 
. : . : . : . : . : . :
rJMSF034L03+ GAGGTGAGACTTAAAAGGTACCTGGAAATGCGAGGGGCCGATGGAGGACCTTGGCGGCGA
rJMFF003M01+ GAGGTGAGACTTAAAAGGTACCTGGAAATGCGAGGGGCCGATGGAGGACCTTGGCGGCGA
rJMFF021L17+ GAGGTGAGACTTAAAAGGTACCTGGAAATGCGAGGGGCCGATGGAGGACCTTGGCGGCGA
rJMFF004P16+ GAGGTGAGACTTAAAAGGTACCTGGAAATGCGAGGGGCCGATGGAGGACCTTGGCGGCGA
                      ____________________________________________________________
consensus GAGGTGAGACTTAAAAGGTACCTGGAAATGCGAGGGGCCGATGGAGGACCTTGGCGGCGA
 
. : . : . : . : . : . :
rJMSF034L03+ TTATGTGCATTGCCTGCTTTCTGGGTTGGTTTATTGTATGATGATATATCTTTACAAAGT
rJMFF003M01+ TTATGTGCATTGCCTGCTTTCTGGGTTGGTTTATTGTATGATGATATATCTTTACAAAGT
rJMFF021L17+ TTATGTGCATTGCCTGCTTTCTGGGTTGGTTTATTGTATGATGATATATCTTTACAAAGT
rJMFF004P16+ TTATGTGCATTGCCTGCTTTCTGGGTTGGTTTATTGTATGATGATATATCTTTACAAAGT
                      ____________________________________________________________
consensus TTATGTGCATTGCCTGCTTTCTGGGTTGGTTTATTGTATGATGATATATCTTTACAAAGT
 
. : . : . : . : . : . :
rJMSF034L03+ GTTCTGGACATGACAGCAGATTGGACTATGGGAGAACGAGAGATGTTAAGGAATAAGGTT
rJMFF003M01+ GTTCTGGACATGACAGCAGATTGGACTATGGGAGAACGAGAGATGTTAAGGAATAAGGTT
rJMFF021L17+ GTTCTGGACATGACAGCAGATTGGACTATGGGAGAACGAGAGATGTTAAGGAATAAGGTT
rJMFF004P16+ GTTCTGGACATGACAGCAGATTGGACTATGGGAGAACGAGAGATGTTAAGGAATAAGGTT
                      ____________________________________________________________
consensus GTTCTGGACATGACAGCAGATTGGACTATGGGAGAACGAGAGATGTTAAGGAATAAGGTT
 
. : . : . : . : . : . :
rJMSF034L03+ CCTAAAAGTGGTTTGAATACACCATTTCGAGACGGTTTGCTCAAGCATGTTGCTCAAGAT
rJMFF003M01+ CCTAAAAGTGGTTTGAATACACCATTTCGAGACGGTTTGCTCAAGCATGTTGCTCAAGAT
rJMFF021L17+ CCTAAAAGTGGTTTGAATACACCATTTCGAGACGGTTTGCTCAAGCATGTTGCTCAAGAT
rJMFF004P16+ CCTAAAAGTGGTTTGAATACACCATTTCGAGACGGTTTGCTCAAGCATGTTGCTCAAGAT
                      ____________________________________________________________
consensus CCTAAAAGTGGTTTGAATACACCATTTCGAGACGGTTTGCTCAAGCATGTTGCTCAAGAT
 
. : . : . : . : . : . :
rJMSF034L03+ GTTCTGCACTTGGCGAAAGGAGGTCTGGAAAGAAGAGGCTATAAGGAAACCGGGTTTCTG
rJMFF003M01+ GTTCTGCACTTGGCGAAAGGAGGTCTGGAAAGAAGAGGCTATAAGGAAACCGGGTTTCTG
rJMFF021L17+ GTTCTGCACTTGGCGAAAGGAGGTCTGGAAAGAAGAGGCTATAAGGAAACCGGGTTTCTG
rJMFF004P16+ GTTCTGCACTTGGCGAAAGGAGGTCTGGAAAGAAGAGGCTATAAGGAAACCGGGTTTCTG
rJMFF041I07+ CTTGGCGAAAGGAGGTCTGGAAAGAAGAGGCTATAAGGAAACCGGGTTTCTG
                      ____________________________________________________________
consensus GTTCTGCACTTGGCGAAAGGAGGTCTGGAAAGAAGAGGCTATAAGGAAACCGGGTTTCTG
 
. : . : . : . : . : . :
rJMSF034L03+ AATGCAGTAGCTGAAGTCGTCAACACAGGCGTGACGCCAGCCGAGAAGCTCCTGGAATTG
rJMFF003M01+ AATGCAGTAGCTGAAGTCGTCAACACAGGCGTGACGCCAGCCGAGAAGCTCCTGGAATTG
rJMFF021L17+ AATGCAGTAGCTGAAGTCGTCAACACAGGCGTGACGCCAGCCGAGAAGCTCCTGGAATTG
rJMFF004P16+ AATGCAGTAGCTGAAGTCGTCAACACAGGCGTGACGCCAGCCGAGAAGCTCCTGGAATTG
rJMFF041I07+ AATGCAGTAGCTGAAGTCGTCAACACAGGCGTGACGCCAGCCGAGAAGCTCCTGGAATTG
                      ____________________________________________________________
consensus AATGCAGTAGCTGAAGTCGTCAACACAGGCGTGACGCCAGCCGAGAAGCTCCTGGAATTG
 
. : . : . : . : . : . :
rJMSF034L03+ TACCATGGGAAATGGGGGCAAAATGTTGATCCTGTATTTGAGGAGCTGCTTTACTGAGGC
rJMFF003M01+ TACCATGGGAAATGGGGGCAAAATGTTGATCCTGTATTTGAGGAGCTGCTTTACTGAGGC
rJMFF021L17+ TACCATGGGAAATGGGGGCAAAATGTTGATCCTGTATTTGAGGAGCTGCTTTACTGAGGC
rJMFF004P16+ TACCATGGGAAATGGGGGCAAAATGTTGATCCTGTATTTGAGGAGCTGCTTTACTGAGGC
rJMFF041I07+ TACCATGGGAAATGGGGGCAAAATGTTGATCCTGTATTTGAGGAGCTGCTTTACTGAGGC
                      ____________________________________________________________
consensus TACCATGGGAAATGGGGGCAAAATGTTGATCCTGTATTTGAGGAGCTGCTTTACTGAGGC
 
. : . : . : . : . : . :
rJMSF034L03+ TAAACAAGAAAGAAGCTGTGTTTTGGGGTTTTGTTTTTGTGGTGTAATCATTCTTCAAAA
rJMFF003M01+ TAAACAAGAAAGAAGCTGTGTTTTGGGGTTTTGTTTTTGTGGTGTAATCATTCTTCAAAA
rJMFF021L17+ TAAACAAGAAAGAAGCTGTGTTTTGGGGTTTTGTTTTTGTGGTGTAATCATTCTTCAAAA
rJMFF004P16+ TAAACAAGAAAGAAGCTGTGTTTTGGGGTTTTGTTTTTGTGGTGTAATCATTCTTCAAAA
rJMFF041I07+ TAAACAAGAAAGAAGCTGTGTTTTGGGGTTTTGTTTTTGTGGGGTAATCATTCTTCAAAA
                      ____________________________________________________________
consensus TAAACAAGAAAGAAGCTGTGTTTTGGGGTTTTGTTTTTGTGGTGTAATCATTCTTCAAAA
 
. : . : . : . : . : . :
rJMSF034L03+ CACTTTAGGGCAACTTGTGTTTAGAATAAAGGTTTGCATACAGAGATGTATTTTGGTCCA
rJMFF003M01+ CACTTTAGGGCAACTTGTGTTTAGAATAAAGGTTTGCATACAGAGATGTATTTTGGTCCA
rJMFF021L17+ CACTTTAGGGCAACTTGTGTTTAGAATAAAGGTTTGCATACAGAGATGTATTTTGGTCCA
rJMFF004P16+ CACTTTAGGGCAACTTGTGTTTAGAATAAAGGTTTGCATACAGAGATGTATTTTGGTCCA
rJMFF041I07+ CACTTTAGGGCAACTTGTGTTTAGAATAAAGGTTTGCATACAGAGATGTATTTTGGTCCA
                      ____________________________________________________________
consensus CACTTTAGGGCAACTTGTGTTTAGAATAAAGGTTTGCATACAGAGATGTATTTTGGTCCA
 
. : . : . : . : . : . :
rJMSF034L03+ ATCTTTGTTGGATATTTATATAGTAGATGGGTGCTTCAGGTTTCAAGCATGCAACCCAAA
rJMFF003M01+ ATCTTTGTTGGATATTTATATAGTAGATGGGTGCTTCAGGTTTCAAGCATGCAACCCAAA
rJMFF021L17+ ATCTTTGTTGGATATTTATATAGTAGATGGGTGCTTCAGGTTTCAAGCATGCAACCCAAA
rJMFF004P16+ ATCTTTGTTGGATATTTATATAGTAGATGGGTGCTTCAGGTTTCAAGCATGCAACCCAAA
rJMFF041I07+ ATCTTTGTTGGATATTTATATAGTAGATGGGTGCTTCAGGTTTCAAGCATGCAACCCAAA
                      ____________________________________________________________
consensus ATCTTTGTTGGATATTTATATAGTAGATGGGTGCTTCAGGTTTCAAGCATGCAACCCAAA
 
. : . : . : . : . : . :
rJMSF034L03+ ACTTTAATTCATACCTTTGGGTGTTAAAATAT
rJMFF003M01+ ACTTTAATTCATA-CTTTGGGTGTTAAAATATCATTTTAAGTTTCGTAGGAATATATTAA
rJMFF021L17+ ACTTTAATTCATA-CTTTGGGTGTTAAAATATCATTTTAAGTTTCGTAGGAATATATTAA
rJMFF004P16+ ACTTTAATTCATA-CTTTGGGTGTTAAAATATCATTTTAAGTTTCGTAGGAATATATTAA
rJMFF041I07+ ACTTTAATTCATA-CTTTGGGTGTTAAAATATCATTTTAAGTTTCGTAGGAATATATTAA
                      ____________________________________________________________
consensus ACTTTAATTCATA-CTTTGGGTGTTAAAATATCATTTTAAGTTTCGTAGGAATATATTAA
 
. : . : . : . : . : . :
rJMFF003M01+ AATTGTTGATCAGACGAGCATGGCGA
rJMFF021L17+ AATTGTTGATCAGACGAGCATGGCGACGTCGTA-TTTAGTACGAGAATC
rJMFF004P16+ AATTGTTGATCAGACGAGCATGGCGACGTCGTATTTTAGTACGAGAATC
rJMFF041I07+ AATTGTTGATCAGACGAGCATGGCGACGTCGTATTTTAGTACGAGAATCATATTCTATCT
                      ____________________________________________________________
consensus AATTGTTGATCAGACGAGCATGGCGACGTCGTATTTTAGTACGAGAATCATATTCTATCT