Previous Contig 010138:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012O09Sequence625000678 (11)gb:AF216386_17780836e-83Arabidopsis thaliana beta-adaptin-like protein B mRNA, complete cds.804010138 (4)gb:AY065000_15661697e-76Arabidopsis thaliana AT4g23460/F16G20_160 mRNA, complete cds.
JMFF041H24Sequence652000678 (11)gb:AF216386_17780833e-88Arabidopsis thaliana beta-adaptin-like protein B mRNA, complete cds.600010138 (4)gb:AY065000_15661691e-42Arabidopsis thaliana AT4g23460/F16G20_160 mRNA, complete cds.
JMSF022D13Sequence657000678 (11)gb:AF216386_17780837e-96Arabidopsis thaliana beta-adaptin-like protein B mRNA, complete cds.775010138 (4)gb:AY065000_15661691e-69Arabidopsis thaliana AT4g23460/F16G20_160 mRNA, complete cds.
JMSF052I19Sequence656000678 (11)gb:AF216386_17780834e-93Arabidopsis thaliana beta-adaptin-like protein B mRNA, complete cds.926010138 (4)gb:AF216386_17780834e-84Arabidopsis thaliana beta-adaptin-like protein B mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052I19+ TACCAGCATCTACTGGTCAAGGGTTTACAAAT
                      ____________________________________________________________
consensus TACCAGCATCTACTGGTCAAGGGTTTACAAAT
 
. : . : . : . : . : . :
rJMSF052I19+ CAGTGCGCAGCTGACGCGTAGAGATGGCCAGATCTTTTACAGCATGTTGTTTGAGAACAA
                      ____________________________________________________________
consensus CAGTGCGCAGCTGACGCGTAGAGATGGCCAGATCTTTTACAGCATGTTGTTTGAGAACAA
 
. : . : . : . : . : . :
rJMFF012O09+ CACTAGATGGATTCATGATTCAATTCAATAAGAATACATTTGGGCTTGC
rJMSF022D13+ AATACATTTGGGCTTGC
rJMSF052I19+ CTCCCAGATTCCACTAGATGGATTCATGATTCAATTCAATAAGAATACATTTGGGCTTGC
                      ____________________________________________________________
consensus CTCCCAGATTCCACTAGATGGATTCATGATTCAATTCAATAAGAATACATTTGGGCTTGC
 
. : . : . : . : . : . :
rJMFF012O09+ TGCTGCTGGACCACTCCAGGTATCGCAATTGCAACCAGGGGCATCTGCAAGTACTCTGTT
rJMSF022D13+ TGCTGCTGGACCACTCCAGGTATCGCNATTGCAACCAGGGGCATCTGCAAGTACTCTGTT
rJMSF052I19+ TGCTGCTGGACCACTCCAGGTATCGCAATTGCAACCAGGGGCATCTGCAAGTACTCTGTT
                      ____________________________________________________________
consensus TGCTGCTGGACCACTCCAGGTATCGCAATTGCAACCAGGGGCATCTGCAAGTACTCTGTT
 
. : . : . : . : . : . :
rJMFF012O09+ GCCCATGGTTTTGTTCCAAAACATTTCTCCAGGTCCTCCTAGCACCC-TTTTGCAGGTTG
rJMSF022D13+ GCCCATGGTTTTGTTCCAAAACATTTCTCCAGGTCCTCCTAGCACCC-TTTTGCAGGTTG
rJMSF052I19+ GCCCATGGTTTTGTTCCAAAACATTTCTCCAGGTCCTCCTAGCACCCTTTTTGCAGGTTG
                      ____________________________________________________________
consensus GCCCATGGTTTTGTTCCAAAACATTTCTCCAGGTCCTCCTAGCACCC-TTTTGCAGGTTG
 
. : . : . : . : . : . :
rJMFF012O09+ CTGTGAAAAATAATCAACAGCCAGTGTGGTACTTCAGTGATAAGATCGCGTTGCATGTAT
rJMSF022D13+ CTGTGAAAAATAATCAACAGCCAGTGTGGTACTTCAGTGATAAGATCGCGTTGCATGTAT
rJMSF052I19+ CTGTGAAAAATAATCAACAGCCAGTGTGGTACTTCAGTGATAAGATCGCGTTGCATGTAT
                      ____________________________________________________________
consensus CTGTGAAAAATAATCAACAGCCAGTGTGGTACTTCAGTGATAAGATCGCGTTGCATGTAT
 
. : . : . : . : . : . :
rJMFF012O09+ TTTATTCCGAGGATGGCAAGATAGAGCGTTCCACTTTTCTTGAGACATGGAAGTCGTTGC
rJMSF022D13+ TTTATTCCGAGGATGGCAAGATAGAGCGTTCCACTTTTCTTGAGACATGGAAGTCGTTGC
rJMSF052I19+ TTTATTCCGAGGATGGCAAGATAGAGCGTTCCACTTTTCTTGAGACATGGAAGTCGTTGC
rJMFF041H24+ TTTATTCCGAGGATGGCAAGATAGAGCGTTCCACTTTTCTTGAGACATGGAAGTCGTTGC
                      ____________________________________________________________
consensus TTTATTCCGAGGATGGCAAGATAGAGCGTTCCACTTTTCTTGAGACATGGAAGTCGTTGC
 
. : . : . : . : . : . :
rJMFF012O09+ CTGATTCAAATGAGATATCGAAGGACTTCCCTGAGCTGGTCATAAACAGTGTGCAGACCA
rJMSF022D13+ CTGATTCAAATGAGATATCGAAGGACTTCCCTGAGCTGGTCATAAACAGTGTGCAGACCA
rJMSF052I19+ CTGATTCAAATGAGATATCGAAGGACTTCCCTGAGCTGGTCATAAACAGTGTGCAGACCA
rJMFF041H24+ CTGATTCAAATGAGATATCGAAGGACTTCCCTGAGCTGGTCATAAACAGTGTGCAGACCA
                      ____________________________________________________________
consensus CTGATTCAAATGAGATATCGAAGGACTTCCCTGAGCTGGTCATAAACAGTGTGCAGACCA
 
. : . : . : . : . : . :
rJMFF012O09+ CCCTTGACCGATTAGCAACATACAACATGTTTTTCATTGCCAAGCGGAAGAGTGCTAACC
rJMSF022D13+ CCCTTGACCGATTAGCAACATACAACATGTTTTTCATTGCCAAGCGGAAGAGTGCTAACC
rJMSF052I19+ CCCTTGACCGATTAGCAACATACAACATGTTTTTCATTGCCAAGCGGAAGAGTGCTAACC
rJMFF041H24+ CCCTTGACCGATTAGCAACATACAACATGTTTTTCATTGCCAAGCGGAAGAGTGCTAACC
                      ____________________________________________________________
consensus CCCTTGACCGATTAGCAACATACAACATGTTTTTCATTGCCAAGCGGAAGAGTGCTAACC
 
. : . : . : . : . : . :
rJMFF012O09+ AAGACGTGCTGTATCTTTCAGCGAAGATTCCTCGAGGGATTTCTTTCTTGATTGAGCTCA
rJMSF022D13+ AAGACGTGCTGTATCTTTCAGCGAAGATTCCTCGAGGGATTTCTTTCTTGATTGAGCTCA
rJMSF052I19+ AAGACGTGCTGTATCTTTCAGCGAAGATTCCTCGAGGGATTTCTTTCTTGATTGAGCTCA
rJMFF041H24+ AAGACGTGCTGTATCTTTCAGCGAAGATTCCTCGAGGGATTTCTTTCTTGATTGAGCTCA
                      ____________________________________________________________
consensus AAGACGTGCTGTATCTTTCAGCGAAGATTCCTCGAGGGATTTCTTTCTTGATTGAGCTCA
 
. : . : . : . : . : . :
rJMFF012O09+ CAGCCACCATTGGAAGTCCTGGTCTCAAGTGTGCAATCAAGACTTCTAACCCTGAAATGG
rJMSF022D13+ CAGCCACCATTGGAAGTCCTGGTCTCAAGTGTGCAATCAAGACTTCTAACCCTGAAATGG
rJMSF052I19+ CAGCCACCATTGGAAGTCCTGGTCTCAAGTGTGCAATCAAGACTTCTAACCCTGAAATGG
rJMFF041H24+ CAGCCACCATTGGAAGTCCTGGTCTCAAGTGTGCAATCAAGACTTCTAACCCTGAAATGG
                      ____________________________________________________________
consensus CAGCCACCATTGGAAGTCCTGGTCTCAAGTGTGCAATCAAGACTTCTAACCCTGAAATGG
 
. : . : . : . : . : . :
rJMFF012O09+ CTCCTCTTTTCTTCGAATCTTTCGAGCCTCTATTCAAGAGCTGATAATGTGTCTTCTCCG
rJMSF022D13+ CTCCTCTTTTCTTCGAATCTTTCGAGCCTCTATTCAAGAGCTGATAATGTGTCTTCTCCG
rJMSF052I19+ CTCCTCTTTTCTTCGAATCTTTCGAGCCTCTATTCAAGAGCTGATAATGTGTCTTCTCCG
rJMFF041H24+ CTCCTCTTTTCTTCGAATCTTTCGAGCCTCTATTCAAGAGCTGATAATGTGTCTTCTCCG
                      ____________________________________________________________
consensus CTCCTCTTTTCTTCGAATCTTTCGAGCCTCTATTCAAGAGCTGATAATGTGTCTTCTCCG
 
. : . : . : . : . : . :
rJMFF012O09+ CATCCTTTTTTCTTTATCATTTGTTTGGCTTTTCTTCTTCTGAGTGGGTCCTCAATTTTC
rJMSF022D13+ CATCCTTTTTTCTTTATCATTTGTTTGGCTTTTCTTCTTCTGAGTGGGTCCTCAATTTTC
rJMSF052I19+ CATCCTTTTTTCTTTATCATTTGTTTGGCTTTTCTTCTTCTGGGTGGGTCCTCAATTTTC
rJMFF041H24+ CATCCTTTTTTCTTTATCATTTGTTTGGCTTTTCTTCTTCTGAGTGGGTCCTCAATTTTC
                      ____________________________________________________________
consensus CATCCTTTTTTCTTTATCATTTGTTTGGCTTTTCTTCTTCTGAGTGGGTCCTCAATTTTC
 
. : . : . : . : . : . :
rJMFF012O09+ CTTTTGTATGATGCTTAGCTTAGTGAACTTCCTACTCGCAACCCCTTTCAACTCTTTCAG
rJMSF022D13+ CTTTTGTATGATGCTTAGCTTAGTGAACTTCCTACTCGCAACCCCTTTCAACTCTTTCAG
rJMSF052I19+ CTTTTGTATGATGCTTAGCTTAGTGAACTTCCTACTCGCAACCCCTTTCAACTCTTTCAG
rJMFF041H24+ CTTTTGTATGATGCTTAGCTTAGTGAACTTCCTACTCGCAACCCCTTTCAACTCTTTCAG
                      ____________________________________________________________
consensus CTTTTGTATGATGCTTAGCTTAGTGAACTTCCTACTCGCAACCCCTTTCAACTCTTTCAG
 
. : . : . : . : . : . :
rJMFF012O09+ TCCAATTTTATTCATTTCAAACATTTTTAGGAATTGAATTTTTGTAGGCCTCATGCAAAA
rJMSF022D13+ TCCAATTTTATTCATTTCAAACATTTTTAGGAATTGAATTTTTGTAGGCCTCATGCAAAA
rJMSF052I19+ TCCAATTTTATTCATTTCAAACATTTTTAGGAATTGAATTTTTGTAGGCCTCATGCAAAA
rJMFF041H24+ TCCAATTTTATTCATTTCAAACATTTTTAGGAATTGAATTTTTGTAGGCCTCATGCAAAA
                      ____________________________________________________________
consensus TCCAATTTTATTCATTTCAAACATTTTTAGGAATTGAATTTTTGTAGGCCTCATGCAAAA
 
. : . : . : . : . : . :
rJMFF012O09+ TGTTATTGTATTAAAAGTTTACCCTTGAAGTCCCTA
rJMSF022D13+ TGTTATTGTATTAAAAGTTTACCCTTGAAGTCCCTA
rJMSF052I19+ TGTTATTGTATTAAAAGTTTACCCTTGAAGTCCCTAATTTATTT
rJMFF041H24+ TGTTATTGTATTAAAAGTTTACCCTTGAAGTCCCTAATTTATTTTGTCAAGAATTCATCG
                      ____________________________________________________________
consensus TGTTATTGTATTAAAAGTTTACCCTTGAAGTCCCTAATTTATTTTGTCAAGAATTCATCG