Previous Contig 010137:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002L20Sequence588006183 (13)gb:BT001131_16353865e-74Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957771010137 (11)gb:BT001131_16353861e-81Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957
JMFF003P13Sequence477006183 (13)gb:BT001131_16353864e-56Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957685010137 (11)gb:BT001131_16353864e-57Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957
JMFF041H21Sequence639006183 (13)pir|T45736|T457365e-89hypothetical protein F24M12.90 - Arabidopsis thaliana>gb:ATF24M12_1549944 Arabid654010137 (11)gb:BT001131_16353862e-52Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957
JMFF047F01Sequence637006183 (13)pir|T45736|T457363e-81hypothetical protein F24M12.90 - Arabidopsis thaliana>gb:ATF24M12_1549944 Arabid572010137 (11)gb:BT001131_16353864e-41Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957
JMSF002M11Sequence276006183 (13)gb:BT001131_16353863e-21Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957735010137 (11)gb:BT001131_16353863e-77Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957
JMSF007A03Sequence263006183 (13)gb:BT001131_16353863e-26Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957765010137 (11)gb:BT001131_16353867e-83Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957
JMSF015N06Sequence491006183 (13)gb:BT001131_16353861e-56Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957766010137 (11)gb:BT001131_16353865e-83Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957
JMSF023O10Sequence589006183 (13)gb:BT001131_16353863e-72Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957731010137 (11)gb:BT001131_16353865e-76Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957
JMSF029B23Sequence624006183 (13)pir|T45736|T457363e-81hypothetical protein F24M12.90 - Arabidopsis thaliana>gb:ATF24M12_1549944 Arabid733010137 (11)gb:BT001131_16353864e-72Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957
JMSF041O01Sequence751006183 (13)pir|T45736|T45736e-102hypothetical protein F24M12.90 - Arabidopsis thaliana>gb:ATF24M12_1549944 Arabid688010137 (11)gb:BT001131_16353862e-65Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957
JMSF045L12Sequence787006183 (13)pir|T45736|T457363e-98hypothetical protein F24M12.90 - Arabidopsis thaliana>gb:ATF24M12_1549944 Arabid769010137 (11)gb:BT001131_16353865e-83Arabidopsis thaliana At3g51050/F24M12_90 mRNA, complete cds.>gb:AF462847_1801957

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF023O10+ CC
rJMSF015N06+ AAATGATGGTCATCATCATCGCAAGGGAAGCC
rJMSF007A03+ CCAAGAAATGATGGTCATCATCATCGCAAGGGAAGCC
rJMSF029B23+ GGAAGCC
rJMSF002M11+ GGAAGCC
rJMSF045L12+ AAATGATGGTCATCATCATCGCAAGGGAAGCC
rJMFF002L20+ AAATGATGGTCATCATCATCGCAAGGGAAGCC
                      ____________________________________________________________
consensus CCAAGAAATGATGGTCATCATCATCGCAAGGGAAGCC
 
. : . : . : . : . : . :
rJMSF023O10+ ATGGAGATGTGATCTTTTTAACAAATCGTGGCGAGGTAACATCTTATTCACCTGGCTTGC
rJMSF015N06+ ATGGAGATGTGATCTTTTTAACAAATCGTGGCGAGGTAACATCTTATTCACCTGGCTTGC
rJMSF007A03+ ATGGAGATGTGATCTTTTTAACAAATCGTGGCGAGGTAACATCTTATTCACCTGGCTTGC
rJMSF029B23+ ATGGAGATGTGATC-TTTTAACAAATCGTGGCGAGGTAACATCTTATTCACCTGGCTTGC
rJMSF002M11+ ATGGAGATGTGATCTTTTTAACAAATCGTGGCGAGGTAACATCTTATTCACCTGGCTTGC
rJMSF045L12+ ATGGAGATGTGATCTTTTTAACAAATCGTGGCGAGGTAACATCTTATTCACCTGGCTTGC
rJMFF003P13+ GGCTTGC
rJMSF041O01+ CTGGCTTGC
rJMFF002L20+ ATGGAGATGTGATCTTTTTAACAAATCGTGGCGAGGTAACATCTTATTCACCTGGCTTGC
                      ____________________________________________________________
consensus ATGGAGATGTGATCTTTTTAACAAATCGTGGCGAGGTAACATCTTATTCACCTGGCTTGC
 
. : . : . : . : . : . :
rJMSF023O10+ ATGGACACGATGCTATCTGGAACTGGCAGCTATTGACTGGTGCAACATGGTCAAACCTTC
rJMSF015N06+ ATGGACACGATGCTATCTGGAACTGGCAGCTATTGACTGGTGCAACATGGTCAAACCTTC
rJMSF007A03+ ATGGACACGATGCTATCTGGAACTGGCAGCTATTGACTGGTGCAACATGGTCAAACCTTC
rJMSF029B23+ ATGGACACGATGCTATCTGGAACTGGCAGCTATTGACTGGTGCAACATGGTCAAACCTTC
rJMSF002M11+ ATGGACACGATGCTATCTGGAACTGGCAGCTATTGACTGGTGCAACATGGTCAAACCTTC
rJMSF045L12+ ATGGACACGATGCTATCTGGAACTGGCAGCTATTGACTGGTGCAACATGGTCAAACCTTC
rJMFF003P13+ ATGGACACGATGCTATCTGGAACTGGCAGCTATTGACTGGTGCAACATGGTCAAACCTTC
rJMSF041O01+ ATGGACACGATGCTATCTGGAACTGGCAGCTATTGACTGGTGCAACATGGTCAAACCTTC
rJMFF002L20+ ATGGACACGATGCTATCTGGAACTGGCAGCTATTGACTGGTGCAACATGGTCAAACCTTC
                      ____________________________________________________________
consensus ATGGACACGATGCTATCTGGAACTGGCAGCTATTGACTGGTGCAACATGGTCAAACCTTC
 
. : . : . : . : . : . :
rJMSF023O10+ CATCTCCATCGGGAATGATGGAAGGTGGTATGGTGGTACCTACCCTGAAGGCATTTTCAT
rJMSF015N06+ CATCTCCATCGGGAATGATGGAAGGTGGTATGGTGGTACCTACCCTGAAGGCATTTTCAT
rJMSF007A03+ CATCTCCATCGGGAATGATGGAAGGTGGTATGGTGGTACCTACCCTGAAGGCATTTTCAT
rJMSF029B23+ CATCTCCATCGGGAATGATGGAAGGTGGTATGGTGGTACCTACCCTGAAGGCATTTTCAT
rJMSF002M11+ CATCTCCATCGGGAATGATGGAAGGTGGTATGGTGGTACCTACCCTGAAGGCATTTTCAT
rJMSF045L12+ CATCTCCATCGGGAATGATGGAAGGTGGTATGGTGGTACCTACCCTGAAGGCATTTTCAT
rJMFF003P13+ CATCTCCATCGGGAATGATGGAAGGTGGTATGGTGGTACCTACCCTGAAGGCATTTTCAT
rJMSF041O01+ CATCTCCATCGGGAATGATGGAAGGTGGTATGGTGGTACCTACCCTGAAGGCATTTTCAT
rJMFF002L20+ CATCTCCATCGGGAATGATGGAAGGTGGTATGGTGGTACCTACCCTGAAGGCATTTTCAT
rJMFF041H21+ CCATCGGGAATGATGGAAGGTGGTATGGTGGTACCTACCCTGAAGGCATTTTCAT
                      ____________________________________________________________
consensus CATCTCCATCGGGAATGATGGAAGGTGGTATGGTGGTACCTACCCTGAAGGCATTTTCAT
 
. : . : . : . : . : . :
rJMSF023O10+ TACGTGTCCATGATAATCAAGAATTGATCCTTGCAGCAGGAGATCAAGAAGCCATAATCA
rJMSF015N06+ TACGTGTCCATGATAATCAAGAATTGATCCTTGCAGCAGGAGATCAAGAAGCCATAATCA
rJMSF007A03+ TACGTGTCCATGATAATCAAGAATTGGTCCTTGCAGCAGGAGATCAAGAAGCCATAATCA
rJMSF029B23+ TACGTGTCCATGATAATCAAGAATTGATCCTTGCAGCAGGAGATCAAGAAGCCATAATCA
rJMSF002M11+ TACGTGTCCATGATAATCAAGAATTGATCCTTGCAGCAGGAGATCAAGAAGCCATAATCA
rJMSF045L12+ TACGTGTCCATGATAATCAAGAATTGATCCTTGCAGCAGGAGATCAAGAAGCCATAATCA
rJMFF003P13+ TACGTGTCCATGATAATCAAGAATTGATCCTTGCAGCAGGAGATCAAGAAGCCATAATCA
rJMSF041O01+ TACGTGTCCATGATAATCAAGAATTGATCCTTGCAGCAGGAGATCAAGAAGCCATAATCA
rJMFF002L20+ TACGTGTCCATGATAATCAAGAATTGATCCTTGCAGCAGGAGATCAAGAAGCCATAATCA
rJMFF047F01+ ATCAAGAATTGATCCTTGCAGCAGGAGATCAAGAAGCCATAATCA
rJMFF041H21+ TACGTGTCCATGATAATCAAGAATTGATCCTTGCAGCAGGAGATCAAGAAGCCATAATCA
                      ____________________________________________________________
consensus TACGTGTCCATGATAATCAAGAATTGATCCTTGCAGCAGGAGATCAAGAAGCCATAATCA
 
. : . : . : . : . : . :
rJMSF023O10+ TATCTCCTGCAGGAAGTATATTAGCAACAATTGAACTTCCTGCTCCTCCCACGCATGCAT
rJMSF015N06+ TATCTCCTGCAGGAAGTATATTAGCAACAATTGAACTTCCTGCTCCTCCCACGCATGCAT
rJMSF007A03+ TATCTCCTGCAGGAAGTATATTAGCAACAATTGAACTTCCTGCTCCTCCCACGCATGCAT
rJMSF029B23+ TATCTCCTGCAGGAAGTATATTAGCAACAATTGAACTTCCTGCTCCTCCCACGCATGCAT
rJMSF002M11+ TATCTCCTGCAGGAAGTATATTAGCAACAATTGAACTTCCTGCTCCTCCCACGCATGCAT
rJMSF045L12+ TATCTCCTGCAGGAAGTATATTAGCAACAATTGAACTTCCTGCTCCTCCCACGCATGCAT
rJMFF003P13+ TATCTCCTGCAGGAAGTATATTAGCAACAATTGAACTTCCTGCTCCTCCCACGCATGCAT
rJMSF041O01+ TATCTCCTGCAGGAAGTATATTAGCAACAATTGAACTTCCTGCTCCTCCCACGCATGCAT
rJMFF002L20+ TATCTCCTGCAGGAAGTATATTAGCAACAATTGAACTTCCTGCTCCTCCCACGCATGCAT
rJMFF047F01+ TATCTCCTGCAGGAAGTATATTAGCAACAATTGAACTTCCTGCTCCTCCCACGCATGCAT
rJMFF041H21+ TATCTCCTGCAGGAAGTATATTAGCAACAATTGAACTTCCTGCTCCTCCCACGCATGCAT
                      ____________________________________________________________
consensus TATCTCCTGCAGGAAGTATATTAGCAACAATTGAACTTCCTGCTCCTCCCACGCATGCAT
 
. : . : . : . : . : . :
rJMSF023O10+ TGGTGACTGAAGATTTTTCCAATGATGGGCTAACCGACCTCATCATTTTGACTTCCAATG
rJMSF015N06+ TGGTGACTGAAGATTTTTCCAATGATGGGCTAACCGACCTCATCATTTTGACTTCCAATG
rJMSF007A03+ TGGTGACTGAAGATTTTTCCAATGATGGGCTAACCGACCTCATCATTTTGACTTCCAATG
rJMSF029B23+ TGGTGACTGAAGATTTTTCCAATGATGGGCTAACCGACCTCATCATTTTGACTTCCAATG
rJMSF002M11+ TGGTGACTGAAGATTTTTCCAATGATGGGCTAACCGACCTCATCATTTTGACTTCCAATG
rJMSF045L12+ TGGTGACTGAAGATTTTTCCAATGATGGGCTAACCGACCTCATCATTTTGACTTCCAATG
rJMFF003P13+ TGGTGACTGAAGATTTTTCCAATGATGGGCTAACCGACCTCATCATTTTGACTTCCAATG
rJMSF041O01+ TGGTGACTGAAGATTTTTCCAATGATGGGCTAACCGACCTCATCATTTTGACTTCCAATG
rJMFF002L20+ TGGTGACTGAAGATTTTTCCAATGATGGGCTAACCGACCTCATCATTTTGACTTCCAATG
rJMFF047F01+ TGGTGACTGAAGATTTTTCCAATGATGGGCTAACCGACCTCATCATTTTGACTTCCAATG
rJMFF041H21+ TGGTGACTGAAGATTTTTCCAATGATGGGCTAACCGACCTCATCATTTTGACTTCCAATG
                      ____________________________________________________________
consensus TGGTGACTGAAGATTTTTCCAATGATGGGCTAACCGACCTCATCATTTTGACTTCCAATG
 
. : . : . : . : . : . :
rJMSF023O10+ GTGTTTATGGCTTTGTTCAGACCAGACAACCCGGTGCACTCTTCTTCAGCACATTGGTTG
rJMSF015N06+ GTGTTTATGGCTTTGTTCAGACCAGACAACCCGGTGCACTCTTCTTCAGCACATTGGTTG
rJMSF007A03+ GTGTTTATGGCTTTGTTCAGACCAGACAACCCGGTGCACTCTTCTTCAGCACATTGGTTG
rJMSF029B23+ GTGTTTATGGCTTTGTTCAGACCAGACAACCCGGTGCACTCTTCTTCAGCACATTGGTTG
rJMSF002M11+ GTGTTTATGGCTTTGTTCAGACCAGACAACCCGGTGCACTCTTCTTCAGCACATTGGTTG
rJMSF045L12+ GTGTTTATGGCTTTGTTCAGACCAGACAACCCGGTGCACTCTTCTTCAGCACATTGGTTG
rJMFF003P13+ GTGTTTATGGCTTTGTTCAGACCAGACAACCCGGTGCACTCTTCTTCAGCACATTGGTTG
rJMSF041O01+ GTGTTTATGGCTTTGTTCAGACCAGACAACCCGGTGCACTCTTCTTCAGCACATTGGTTG
rJMFF002L20+ GTGTTTATGGCTTTGTTCAGACCAGACAACCCGGTGCACTCTTCTTCAGCACATTGGTTG
rJMFF047F01+ GTGTTTATGGCTTTGTTCAGACCAGACAACCCGGTGCACTCTTCTTCAGCACATTGGTTG
rJMFF041H21+ GTGTTTATGGCTTTGTTCAGACCAGACAACCCGGTGCACTCTTCTTCAGCACATTGGTTG
                      ____________________________________________________________
consensus GTGTTTATGGCTTTGTTCAGACCAGACAACCCGGTGCACTCTTCTTCAGCACATTGGTTG
 
. : . : . : . : . : . :
rJMSF023O10+ GTTGCCTTATTGTTGTAATGGGAGTGCTATTTGTCTCCCAACATCTAAACTCAATCAAGG
rJMSF015N06+ GTTGCCTTATTGTTGTAATGGGAGTGCTATTTGTCTCCCAACATCTAAACTCAATCAAGG
rJMSF007A03+ GTTGCCTTATTGTTGTAATGGGAGTGCTATTTGTCTCCCAACATCTAAACTCAATCAAGG
rJMSF029B23+ GTTGCCTTATTGTTGTAATGGGAGTGCTATTTGTCTCCCAACATCTAAACTCAATCAAGG
rJMSF002M11+ GTTGCCTTATTGTTGTAATGGGAGTGCTATTTGTCTCCCAACATCTAAACTCAATCAAGG
rJMSF045L12+ GTTGCCTTATTGTTGTAATGGGAGTGCTATTTGTCTCCCAACATCTAAACTCAATCAAGG
rJMFF003P13+ GTTGCCTTATGGTTGTAATGGGAGTGCTATTTGTCTCCCAACATCTAAACTCAATCAAGG
rJMSF041O01+ GTTGCCTTATTGTTGTAATGGGAGTGCTATTTGTCTCCCAACATCTAAACTCAATCAAGG
rJMFF002L20+ GTTGCCTTATTGTTGTAATGGGAGTGCTATTTGTCTCCCAACATCTAAACTCAATCAAGG
rJMFF047F01+ GTTGCCTTATTGTTGTAATGGGAGTGCTATTTGTCTCCCAACATCTAAACTCAATCAAGG
rJMFF041H21+ GTTGCCTTATTGTTGTAATGGGAGTGCTATTTGTCTCCCAACATCTAAACTCAATCAAGG
                      ____________________________________________________________
consensus GTTGCCTTATTGTTGTAATGGGAGTGCTATTTGTCTCCCAACATCTAAACTCAATCAAGG
 
. : . : . : . : . : . :
rJMSF023O10+ GAAAACCTCGAGCTTCATCTGGTCAATTCTAACAAGAACAAGTTTGTGCTTACCATTACA
rJMSF015N06+ GAAAACCTCGAGCTTCATCTGGTCAATTCTAACAAGAACAAGTTTGTGCTTACCATTACA
rJMSF007A03+ GAAAACCTCGAGCTTCATCTGGTCAATTCTAACAAGAACAAGTTTGTGCTTACCATTACA
rJMSF029B23+ GAAAACCTCGAGCTTCATCTGGTCAATTCTAACAAGAACAAGTTTGTGCTTACCATTACA
rJMSF002M11+ GAAAACCTCGAGCTTCATCTGGTCAATTCTAACAAGAACAAGTTTGTGCTTACCATTACA
rJMSF045L12+ GAAAACCTCGAGCTTCATCTGGTCAATTCTAACAAGAACAAGTTTGTGCTTACCATTACA
rJMFF003P13+ GAAAACCTCGAGCTTCATCTGGTCAATTCTAACAAGAACAAGTTTGTGCTTACCATTACA
rJMSF041O01+ GAAAACCTCGAGCTTCATCTGGTCAATTCTAACAAGAACAAGTTTGTGCTTACCATTACA
rJMFF002L20+ GAAAACCTCGAGCTTCATCTGGTCAATTCTAACAAGAACAAGTTTGTGCTTACCATTACA
rJMFF047F01+ GAAAACCTCGAGCTTCATCTGGTCAATTCTAACAAGAACAAGTTTGTGCTTACCATTACA
rJMFF041H21+ GAAAACCTCGAGCTTCATCTGGTCAATTCTAACAAGAACAAGTTTGTGCTTACCATTACA
                      ____________________________________________________________
consensus GAAAACCTCGAGCTTCATCTGGTCAATTCTAACAAGAACAAGTTTGTGCTTACCATTACA
 
. : . : . : . : . : . :
rJMSF023O10+ AGAGGCAAATGTTTTTCCCTCGAGCCGCAGAAATGCTGTGGAGATTACTGAATGATGAGA
rJMSF015N06+ AGAGGCAAATGTTTTTCCCTCGAGCCGCAGAAATGCTGTGGAGATTACTGAATGATGAGA
rJMSF007A03+ AGAGGCAAATGTTTTTCCCTCGAGCCGCAGAAATGCTGTGGAGATTACTGAATGATGAGA
rJMSF029B23+ AGAGGCAAATGTTTTTCCCTCGAGCCGCAGAAATGCTGTGGAGATTACTGAATGATGAGA
rJMSF002M11+ AGAGGCAAATGTTTTTCCCTCGAGCCGCAGAAATGCTGTGGAGATTACTGAATGATGAGA
rJMSF045L12+ AGAGGCAAATGTTTTTCCCTCGAGCCGCAGAAATGCTGTGGAGATTACTGAATGATGAGA
rJMFF003P13+ AGAGGCAAATGTTTTTCCCTCGAGCCGCAGAAATGCTGTGGAGATTACTGAATGATGAGA
rJMSF041O01+ AGAGGCAAATGTTTTTCCCTCGAGCCGCAGAAATGCTGTGGAGATTACTGAATGATGAGA
rJMFF002L20+ AGAGGCAAATGTTTTTCCCTCGAGCCGCAGAAATGCTGTGGAGATTACTGAATGATGAGA
rJMFF047F01+ AGAGGCAAATGTTTTTCCCTCGAGCCGCAGAAATGCTGTGGAGATTACTGAATGATGAGA
rJMFF041H21+ AGAGGCAAATGTTTTTCCCTCGAGCCGCAGAAATGCTGTGGAGATTACTGAATGATGAGA
                      ____________________________________________________________
consensus AGAGGCAAATGTTTTTCCCTCGAGCCGCAGAAATGCTGTGGAGATTACTGAATGATGAGA
 
. : . : . : . : . : . :
rJMSF023O10+ TGAGGTGAGATATAGTGGACAGAAAACGAGGTGAAAACATACTTGGTTGACAGGGCAAAA
rJMSF015N06+ TGAGGTGAGATATAGTGGACAGAAAACGAGGTGAAAACATACTTGGTTGACAGGGCAAAA
rJMSF007A03+ TGAGGTGAGATATAGTGGACAGAAAACGAGGTGAAAACATACTTGGTTGACAGGGCAAAA
rJMSF029B23+ TGAGGTGAGATATAGTGGACAGAAAACGAGGTGAAAACATACTTGGTTGACAGGGCAAAA
rJMSF002M11+ TGAGGTGAGATATAGTGGACAGAAAACGAGGTGAAAACATACTTGGTTGACAGGGCAAAA
rJMSF045L12+ TGAGTTGAGATATAGTGGACAGAAAACGAGGTGAAAACATACTTGGTTGACAGGGCAAAA
rJMFF003P13+ TGAGGTGAGATATAGTGGACAGAAAACGAGGTGAAAACATACTTGGTTGACAGGGCAAAA
rJMSF041O01+ TGAGGTGAGATATAGTGGACAGAAAACGAGGTGAAAACATACTTGGTTGACAGGGCAAAA
rJMFF002L20+ TGAGGTGAGATATAGTGGACAGAAAACGAGGTGAAAACATACTTGGTTGACAGGGCAAAA
rJMFF047F01+ TGAGGTGAGATATAGTGGACAGAAAACGAGGTGAAAACATACTTGGTTGACAGGGCAAAA
rJMFF041H21+ TGAGGTGAGATATAGTGGACAGAAAACGAGGTGAAAACATACTTGGTTGACAGGGCAAAA
                      ____________________________________________________________
consensus TGAGGTGAGATATAGTGGACAGAAAACGAGGTGAAAACATACTTGGTTGACAGGGCAAAA
 
. : . : . : . : . : . :
rJMSF023O10+ ATTTGCAAACTAGACAGGATTAATGGATTTTGAGTGAACCCATGTAGGTATTGTGTATTG
rJMSF015N06+ ATTTGCAAACTAGACAGGATTAATGGATTTTGAGTGAACCCATGTAGGTATTGTGTATTG
rJMSF007A03+ ATTTGCAAACTAGACAGGATTAATGGATTTTGAGTGAA-CCATGTAGGTATTGTGTATTG
rJMSF029B23+ ATTTGCAAACTAGACAGGATTAATGGATTTTGAGTGAA-CCATGTAGGTATTGTGTATTG
rJMSF002M11+ ATTTGCAAACTAGACAGGATTAATGGATTTTGAGTGAA-CCATGTAGGTATTGTGTATTG
rJMSF045L12+ ATTTGCAAACTAGACAGGATTAATGGATTTTGAGTGAA-CCATGTAGGTATTGTGTATTG
rJMFF003P13+ ATTTGCAAACTAGACAGGATTAATGGATTTTGAGTGAA-CCATGTAGGTATTGTGTATTG
rJMSF041O01+ ATTTGCAAACTAGACAGGATTAATGGATTTTGAGTGAA-CCATGTAGGTATTGTGTATTG
rJMFF002L20+ ATTTGCAAACTAGACAGGATTAATGGATTTTGAGTGAA-CCATGTAGGTATTGTGTATTG
rJMFF047F01+ ATTTGCAAACTAGACAGGATTAATGGATTTTGAGTGAA-CCATGTAGGTATTGTGTATCG
rJMFF041H21+ ATTTGCAAACTAGACAGGATTAATGGATTTTGAGTGAA-CCATGTAGGTATTGTGTATTG
                      ____________________________________________________________
consensus ATTTGCAAACTAGACAGGATTAATGGATTTTGAGTGAA-CCATGTAGGTATTGTGTATTG
 
. : . : . : . : . : . :
rJMSF023O10+ TACCC-TAAC
rJMSF015N06+ TACCC-TAAC
rJMSF007A03+ TACCC-TAAC
rJMSF029B23+ TACCCTAA
rJMSF002M11+ TACCC-TAAC
rJMSF045L12+ TACCC-TAAC
rJMFF003P13+ TACCCTTAACATTAACGGT
rJMSF041O01+ TACCCTTAACAT
rJMFF002L20+ TACCCTTAACATTAACGGT
rJMFF047F01+ TACCCTTAACATTAACGGTATATATTATGTATGCATT
rJMFF041H21+ TACCCTTAACATTAACGGTATATATTATGTATGCATTAATTTGGGCAAAAAAAAAAAAAA
                      ____________________________________________________________
consensus TACCCTTAACATTAACGGTATATATTATGTATGCATTAATTTGGGCAAAAAAAAAAAAAA