Previous Contig 010128:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002N16Sequence535010128 (26)gb:BC003883_20894262e-59Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA
JMFF004B12Sequence584010128 (26)gb:BC003883_20894268e-90Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA718010128 (26)gb:BC003883_20894263e-05Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA
JMFF005N12Sequence411010128 (26)gb:BC003883_20894261e-55Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA705010128 (26)gb:BC003883_20894265e-05Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA
JMFF007L12Sequence548010128 (26)gb:BC003883_20894262e-81Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA785010128 (26)gb:BC003883_20894264e-05Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA
JMFF014K10Sequence537010128 (26)gb:BC003883_20894261e-78Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA808010128 (26)gb:BC003883_20894264e-05Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA
JMFF018M03Sequence534010128 (26)gb:BC003883_20894261e-78Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA849010128 (26)gb:BC003883_20894264e-05Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA
JMFF019I23Sequence582010128 (26)gb:BC003883_20894268e-90Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA719010128 (26)gb:BC003883_20894263e-05Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA
JMFF021A08Sequence580010128 (26)gb:BC003883_20894268e-90Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA763010128 (26)gb:BC003883_20894263e-05Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA
JMFF024E20Sequence446010128 (26)gb:BC003883_20894263e-61Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA778010128 (26)gb:BC003883_20894264e-05Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA
JMFF040B13Sequence574010128 (26)gb:BC003883_20894263e-05Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA
JMFF041F23Sequence629010128 (26)gb:BC003883_20894263e-97Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA640010128 (26)gb:BC003883_20894262e-05Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA
JMFF041H10Sequence657010128 (26)gb:BC003883_20894261e-96Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA600010128 (26)gb:BC003883_20894262e-05Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA
JMFN018I07Sequence610010128 (26)gb:BC003883_20894267e-92Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA
JMFS051E11Sequence580010128 (26)gb:BC003883_20894267e-96Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA
JMSF014B16Sequence326010128 (26)gb:BC003883_20894265e-40Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA849010128 (26)gb:BC003883_20894264e-05Mus musculus mRNA similar to RIKEN cDNA 2010107D16 gene (cDNA clone MGC:6653 IMA

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF002N16- GTGGTGACTAGATTAGCCCTAATTTACCTGGAAAGGAAATCCT
                      ____________________________________________________________
consensus GTGGTGACTAGATTAGCCCTAATTTACCTGGAAAGGAAATCCT
 
. : . : . : . : . : . :
JMFF002N16- ACAAATAGCTATAAAAATAGAGAAACCCTAATTTTGTTCTTAAGCTAGGTGAATTATTAT
JMFF019I23- AATTATAGTAAAGCTTTAG
JMFF018M03- AATTATAGTAAAGCTTTAG
JMFF014K10- AATTATAGTAAAGCTTTAG
JMFF024E20- ATAGTAAAGCTTTAG
JMFF007L12- AATTATAGTAAAGCTTTAG
JMSF014B16- ATAGTAAAGCTTTAG
JMFF005N12- AATTATAGTAAAGCTTTAG
JMFF004B12- AATTTTAGTAAAGCTTTAG
JMFF021A08- ATAGTAAAGCTTTAG
JMFF041F23- ATTATAGTAAAGCTTTAG
JMFF041H10- ATAGTAAAGCTTTAG
                      ____________________________________________________________
consensus ACAAATAGCTATAAAAATAGAGAAACCCTAATTTTGTTCTTAATTATAGTAAAGCTTTAG
 
. : . : . : . : . : . :
JMFF002N16- CGAAGAGATC-GAATAGAAATAGAGAGAAAGCAGGCGGTATAGAATGGCGGAGCACTTGG
JMFF019I23- AGTTTGGAGCTGAATTCACAGACGGCGAAGAAAGGGGG---AAAATGGCGGAGCACTTGG
JMFF018M03- AGTTTGGAGCTGAATTCACAGACGGCGAAGAAAGGGGG---AAAATGGCGGAGCACTTGG
JMFF014K10- AGTTTGGAGCTGAATTCACAGACGGCGAAGAAAGGGGG---AAAATGGCGGAGCACTTGG
JMFF024E20- AGTTTGGAGCTGAATTCACAGACGGCGAAGAAAGGGGG---AAAATGGCGGAGCACTTGG
JMFF007L12- AGTTTGGAGCTGAATTCACAGACGGCGAAGAAAGGGGG---AAAATGGCGGAGCACTTGG
JMSF014B16- AGTTTGGAGCTGAATTCACAGACGGCGAAGAAAGGGGG---AAAATGGCGGAGCACTTGG
JMFF005N12- AGTTTGGAGCTGAATTCACAGACGGCGAAGAAAGGGGG---AAAATGGCGGAGCACTTGG
JMFF004B12- AGTTTGGAGCTGAATTCACAGACGGCGAAGAAAGGGGG---AAAATGGCGGAGCACTTGG
JMFF021A08- AGTTTGGAGCTGAATTCACAGACGGCGAAGAAAGGGGG---AAAATGGCGGAGCACTTGG
JMFF041F23- AGTTTGGAGCTGAATTCACAGACGGCGAAGAAAGGGGG---AAAATGGCGGAGCACTTGG
JMFS051E11- ACAGACGGCGAAGAAAGGGGG---AAAATGGCGGAGCACTTGG
JMFF041H10- AGTTTGGAGCTGAATTCACAGACGGCGAAGAAAGGGGG---AAAATGGCGGAGCACTTGG
                      ____________________________________________________________
consensus AGTTTGGAGCTGAATTCACAGACGGCGAAGAAAGGGGG---AAAATGGCGGAGCACTTGG
 
. : . : . : . : . : . :
JMFF002N16- CGTCGATATTCGGAACGGAGAAGGACAGGGTGAACTGCCCCTTCTACTTCAAGATAGGTG
JMFF019I23- CGTCCATATTCGGAACAGAGAAGGACAGGGTGAACTGCCCCTTCTACTTCAAGATTGGCG
JMFF018M03- CGTCCATATTCGGAACAGAGAAGGACAGGGTGAACTGCCCCTTCTACTTCAAGATTGGCG
JMFF014K10- CGTCCATATTCGGAACAGAGAAGGACAGGGTGAACTGCCCCTTCTACTTCAAGATTGGCG
JMFF024E20- CGTCCATATTCGGAACAGAGAAGGACAGGGTGAACTGCCCCTTCTACTTCAAGATTGGCG
JMFF007L12- CGTCCATATTCGGAACAGAGAAGGACAGGGTGAACTGCCCCTTCTACTTCAAGATTGGCG
JMSF014B16- CGTCCATATTCGGAACAGAGAAGGACAGGGTGAACTGCCCCTTCTACTTCAAGATTGGCG
JMFF005N12- CGTCCATATTCGGAACAGAGAAGGACAGGGTGAACTGCCCCTTCTACTTCAAGATTGGCG
JMFF004B12- CGTCCATATTCGGAACAGAGAAGGACAGGGTGAACTGCCCCTTCTACTTCAAGATTGGCG
JMFF021A08- CGTCCATATTCGGAACAGAGAAGGACAGGGTGAACTGCCCCTTCTACTTCAAGATTGGCG
JMFF041F23- CGTCCATATTCGGAACAGAGAAGGACAGGGTGAACTGCCCCTTCTACTTCAAGATTGGCG
JMFS051E11- CGTCCATATTCGGAACAGAGAAGGACAGGGTGAACTGCCCCTTCTACTTCAAGATTGGCG
JMFF041H10- CGTCCATATTCGGAACAGAGAAGGACAGGGTGAACTGCCCCTTCTACTTCAAGATTGGCG
JMFN018I07+ AGGACAGGGTGAACTGCCCCTTCTACTTCAAGATTGGCG
                      ____________________________________________________________
consensus CGTCCATATTCGGAACAGAGAAGGACAGGGTGAACTGCCCCTTCTACTTCAAGATTGGCG
 
. : . : . : . : . : . :
JMFF002N16- CTTGCCGGCACGGCGATCGCTGCTCTCGCCTTCACACCAAGCCTAGCATCAGCCCCACCC
JMFF019I23- CTTGCCGCCACGGCGACCGCTGCTCTCGCCTCCACACCAAGCCCAGCATCAGCCCCACCC
JMFF018M03- CTTGCCGCCACGGCGACCGCTGCTCTCGCCTCCACACCAAGCCCAGCATCAGCCCCACCC
JMFF014K10- CTTGCCGCCACGGCGACCGCTGCTCTCGCCTCCACACCAAGCCCAGCATCAGCCCCACCC
JMFF024E20- CTTGCCGCCACGGCGACCGCTGCTCTCGCCTCCACACCAAGCCCAGCATCAGCCCCACCC
JMFF007L12- CTTGCCGCCACGGCGACCGCTGCTCTCGCCTCCACACCAAGCCCAGCATCAGCCCCACCC
JMSF014B16- CTTGCCGCCACGGCGACCGCTGCTCTCGCCTCCACACCAAGCCCAGCATCAGCCCCACCC
JMFF005N12- CTTGCCGCCACGGCGACCGCTGCTCTCGCCTCCACACCAAGCCCAGCATCAGCCCCACCC
JMFF004B12- CTTGCCGCCACGGCGACCGCTGCTCTCGCCTCCACACCAAGCCCAGCATCAGCCCCACCC
JMFF021A08- CTTGCCGCCACGGCGACCGCTGCTCTCGCCTCCACACCAAGCCCAGCATCAGCCCCACCC
JMFF041F23- CTTGCCGCCACGGCGACCGCTGCTCTCGCCTCCACACCAAGCCCAGCATCAGCCCCACCC
JMFS051E11- CTTGCCGCCACGGCGACCGCTGCTCTCGCCTCCACACCAAGCCCAGCATCAGCCCCACCC
JMFF041H10- CTTGCCGCCACGGCGACCGCTGCTCTCGCCTCCACACCAAGCCCAGCATCAGCCCCACCC
JMFN018I07+ CTTGCCGCCACGGCGACCGCTGCTCTCGCCTCCACACCAAGCCCAGCATCAGCCCCACCC
                      ____________________________________________________________
consensus CTTGCCGCCACGGCGACCGCTGCTCTCGCCTCCACACCAAGCCCAGCATCAGCCCCACCC
 
. : . : . : . : . : . :
JMFF002N16- TTCTCCTCTCCAACATGTACCAACGCCCCGACATGATCACACCCGGCGTTGACCCCCAAG
JMFF019I23- TCCTCCTCTCCAACATGTACCAGCGCCCCGACATGATTACTCCCGGCGTTGACCCTCAAG
JMFF018M03- TCCTCCTCTCCAACATGTACCAGCGCCCCGACATGATTACTCCCGGCGTTGACCCTCAAG
JMFF014K10- TCCTCCTCTCCAACATGTACCAGCGCCCCGACATGATTACTCCCGGCGTTGACCCTCAAG
JMFF024E20- TCCTCCTCTCCAACATGTACCAGCGCCCCGACATGATTACTCCCGGCGTTGACCCTCAAG
JMFF007L12- TCCTCCTCTCCAACATGTACCAGCGCCCCGACATGATTACTCCCGGCGTTGACCCTCAAG
JMSF014B16- TCCTCCTCTCCAACATGTACCAGCGCCCCGACATGATTACTCCCGGCGTTGACCCTCAAG
JMFF005N12- TCCTCCTCTCCAACATGTACCAGCGCCCCGACATGATTACTCCCGGCGTTGACCCTCAAG
JMFF004B12- TCCTCCTCTCCAACATGTACCAGCGCCCCGACATGATTACTCCCGGCGTTGACCCTCAAG
JMFF021A08- TCCTCCTCTCCAACATGTACCAGCGCCCCGACATGATTACTCCCGGCGTTGACCCTCAAG
JMFF041F23- TCCTCCTCTCCAACATGTACCAGCGCCCCGACATGATTACTCCCGGCGTTGACCCTCAAG
JMFS051E11- TCCTCCTCTCCAACATGTACCAGCGCCCCGACATGATTACTCCCGGCGTTGACCCTCAAG
JMFF041H10- TCCTCCTCTCCAACATGTACCAGCGCCCCGACATGATTACTCCCGGCGTTGACCCTCAAG
JMFN018I07+ TCCTCCTCTCCAACATGTACCAGCGCCCCGACATGATTACTCCCGGCGTTGACCCTCAAG
                      ____________________________________________________________
consensus TCCTCCTCTCCAACATGTACCAGCGCCCCGACATGATTACTCCCGGCGTTGACCCTCAAG
 
. : . : . : . : . : . :
JMFF002N16- GCCAACCTCTCGATCCCCGCAAGATCCAACGCCACTTCGAGGACTTCTACGAGGATTTGT
JMFF019I23- GTCAGCCTCTCGATCCCCGCAAGATCCAACACCACTTCGAGGACTTCTATGAGGATTTGT
JMFF018M03- GTCAGCCTCTCGATCCCCGCAAGATCCAACACCACTTCGAGGACTTCTATGAGGATTTGT
JMFF014K10- GTCAGCCTCTCGATCCCCGCAAGATCCAACACCACTTCGAGGACTTCTATGAGGATTTGT
JMFF024E20- GTCAGCCTCTCGATCCCCGCAAGATCCAACACCACTTCGAGGACTTCTATGAGGATTTGT
JMFF007L12- GTCAGCCTCTCGATCCCCGCAAGATCCAACACCACTTCGAGGACTTCTATGAGGATTTGT
JMSF014B16- GTCAGCCTCTCGATCCCCGCAAGATCCAACACCACTTCGAGGACTTCTATGAGGATTTGT
JMFF005N12- GTCAGCCTCTCGATCCCCGCAAGATCCAACACCACTTCGAGGACTTCTATGAGGATTTGT
JMFF004B12- GTCAGCCTCTCGATCCCCGCAAGATCCAACACCACTTCGAGGACTTCTATGAGGATTTGT
JMFF021A08- GTCAGCCTCTCGATCCCCGCAAGATCCAACACCACTTCGAGGACTTCTATGAGGATTTGT
JMFF041F23- GTCAGCCTCTCGATCCCCGCAAGATCCAACACCACTTCGAGGACTTCTATGAGGATTTGT
JMFS051E11- GTCAGCCTCTCGATCCCCGCAAGATCCAACACCACTTCGAGGACTTCTATGAGGATTTGT
JMFF041H10- GTCAGCCTCTCGATCCCCGCAAGATCCAACACCACTTCGAGGACTTCTATGAGGATTTGT
JMFN018I07+ GTCAGCCTCTCGATCCCCGCAAGATCCAACACCACTTCGAGGACTTCTATGAGGATTTGT
                      ____________________________________________________________
consensus GTCAGCCTCTCGATCCCCGCAAGATCCAACACCACTTCGAGGACTTCTATGAGGATTTGT
 
. : . : . : . : . : . :
JMFF002N16- TTGAGGAGCTTAGCAAGCATGGAGAGATTGAGAATCTTAACATCTGTGATAATTTAGCTG
JMFF019I23- TTGAGGAGCTTAGTAAATACGGAGAGATTGAGAATCTTAACATCTGTGATAATTTAGCAG
JMFF018M03- TTGAGGAGCTTAGTAAATACGGAGAGATTGAGAATCTTAACATCTGTGATAATTTAGCAG
JMFF014K10- TTGAGGAGCTTAGTAAATACGGAGAGATTGAGAATCTTAACATCTGTGATAATTTAGCAG
JMFF024E20- TTGAGGAGCTTAGTAAATACGGAGAGATTGAGAATCTTAACATCTGTGATAATTTAGCAG
JMFF007L12- TTGAGGAGCTTAGTAAATACGGAGAGATTGAGAATCTTAACATCTGTGATAATTTAGCAG
JMSF014B16- TTGAGGAGCTTAG
JMFF005N12- TTGAGGAGCTTAGTAAATACGGAGAGATTGAGAATCTTAACATCTGTGATAATTTAGCAG
JMFF004B12- TTGAGGAGCTTAGTAAATACGGAGAGATTGAGAATCTTAACATCTGTGATAATTTAGCAG
JMFF021A08- TTGAGGAGCTTAGTAAATACGGAGAGATTGAGAATCTTAACATCTGTGATAATTTAGCAG
JMFF041F23- TTGAGGAGCTTAGTAAATACGGAGAGATTGAGAATCTTAACATCTGTGATAATTTAGCAG
JMFS051E11- TTGAGGAGCTTAGTAAATACGGAGAGATTGAGAATCTTAACATCTGTGATAATTTAGCAG
JMFF041H10- TTGAGGAGCTTAGTAAATACGGAGAGATTGAGAATCTTAACATCTGTGATAATTTAGCAG
JMFN018I07+ TTGAGGAGCTTAGTAAATACGGAGAGATTGAGAATCTTAACATCTGTGATAATTTAGCAG
                      ____________________________________________________________
consensus TTGAGGAGCTTAGTAAATACGGAGAGATTGAGAATCTTAACATCTGTGATAATTTAGCAG
 
. : . : . : . : . : . :
JMFF002N16- ACCACATGGTGGGTAATGTATATGTTCAGTTTAGGGAAGAAGAGCATGCTGCAACTGCTC
JMFF019I23- ACCACATGGTGGGCAATGTGTATGTACAGTTCAGGGAGGAGGAACATGCTGCTACTGCCC
JMFF018M03- ACCACATGGTGGGCAATGTGTATGTACAGTTCAGGGAGGAGGAACATGCTGCTACTGCCC
JMFF014K10- ACCACATGGTGGGCAATGTGTATGTACAGTTCAGGGAGGAGGAACATGCTGCTACTGCCC
JMFF024E20- ACCACATGGTGGGCAATGTGTATGTACAGTTCAGGGAGGAGGAACATGCTGCTACTGCCC
JMFF007L12- ACCACATGGTGGGCAATGTGTATGTACAGTTCAGGGAGGAGGAACATGCTGCTACTGCCC
JMFF005N12- ACCACATGGTGGGCAATGTGTATGTACAGTTCAGG
JMFF004B12- ACCACATGGTGGGCAATGTGTATGTACAGTTCAGGGAGGAGGAACATGCTGCTACTGCCC
JMFF021A08- ACCACATGGTGGGCAATGTGTATGTACAGTTCAGGGAGGAGGAACATGCTGCTACTGCCC
JMFF041F23- ACCACATGGTGGGCAATGTGTATGTACAGTTCAGGGAGGAGGAACATGCTGCTACTGCCC
JMFS051E11- ACCACATGGTGGGCAATGTGTATGTACAGTTCAGGGAGGAGGAACATGCTGCTACTGCCC
JMFF041H10- ACCACATGGTGGGCAATGTGTATGTACAGTTCAGGGAGGAGGAACATGCTGCTACTGCCC
JMFN018I07+ ACCACATGGTGGGCAATGTGTATGTACAGTTCAGGGAGGAGGAACATGCTGCTACTGCCC
                      ____________________________________________________________
consensus ACCACATGGTGGGCAATGTGTATGTACAGTTCAGGGAGGAGGAACATGCTGCTACTGCCC
 
. : . : . : . : . : . :
JMFF002N16- T
JMFF019I23- TTCAGAATCTGTCAGGAAGGTTCTATGCAGGGCGCCCTATTATTGTTGACTTCTCGCCAG
JMFF018M03- TTCAGAATCTGTCAGGAAGGTTCTATGCAGGGCGCCCTATTATTGTTGACTTCTCGCCAG
JMFF014K10- TTCAGAATCTGTCAGGAAGGTTCTATGCAGGGCGCCCTATTATTGTTGACTTCTCGCCAG
JMFF024E20- TTCAGAATCTGTCA
JMFF007L12- TTCAGAATCTGTCAGGAAGGTTCTATGCAGGGCGCCCTATTATTGTTGACTTCTCGCCAG
JMFF004B12- TTCAGAATCTGTCAGGAAGGTTCTATGCAGGGCGCCCTATTATTGTTGACTTCTCGCCAG
JMFF021A08- TTCAGAATCTGTCAGGAAGGTTCTATGCAGGGCGCCCTATTATTGTTGACTTCTCGCCAG
JMFF041F23- TTCAGAATCTGTCAGGAAGGTTCTATGCAGGGCGCCCTATTATTGTTGACTTCTCGCCAG
JMFS051E11- TTCAGAATCTGTCAGGAAGGTTCTATGCAGGGCGCCCTATTATTGTTGACTTCTCGCCAG
JMFF041H10- TTCAGAATCTGTCAGGAAGGTTCTATGCAGGGCGCCCTATTATTGTTGACTTCTCGCCAG
JMFN018I07+ TTCAGAATCTGTCAGGAAGGTTCTATGCAGGGCGCCCTATTATTGTTGACTTCTCGCCAG
                      ____________________________________________________________
consensus TTCAGAATCTGTCAGGAAGGTTCTATGCAGGGCGCCCTATTATTGTTGACTTCTCGCCAG
 
. : . : . : . : . : . :
JMFF019I23- TGACCGACTTTCGTGAAGCAACTTGTAGGCAGTATGAGGAAAATGTGTGTAACCGAGGTG
JMFF018M03- TGACCGACTTTCGTGAAGCAACTTGTAGGCAGTATGAG
JMFF014K10- TGACCGACTTTCGTGAAGCAACTTGTANGCAGTATGAGGAA
JMFF007L12- TGACCGACTTTCGTGAAGCAACTTGTAGGCAGTATGAGGAAAATGTGTGTAA
JMFF004B12- TGACCGACTTTCGTGAAGCAACTTGTAGGCAGTATGAGGAAAATGTGTGTAACCGAGGTG
JMFF021A08- TGACCGACTTTCGTGAAGCAACTTGTAGGCAGTATGAGGAAAATGTGTGTAACCGAGGTG
JMFF041F23- TGACCGACTTTCGTGAAGCAACTTGTAGGCAGTATGAGGAAAATGTGTGTAACCGAGGTG
JMFS051E11- TGACCGACTTTCGTGAAGCAACTTGTAGGCAGTATGAGGAAAATGTGTGTAACCGAGGTG
JMFF041H10- TGACCGACTTTCGTGAAGCAACTTGTAGGCAGTATGAGGAAAATGTGTGTAACCGAGGTG
JMFN018I07+ TGACCGACTTTCGTGAAGCAACTTGTAGGCAGTATGAGGAAAATGTGTGTAACCGAGGTG
                      ____________________________________________________________
consensus TGACCGACTTTCGTGAAGCAACTTGTAGGCAGTATGAGGAAAATGTGTGTAACCGAGGTG
 
. : . : . : . : . : . :
JMFF019I23- GCTATTGCAACTTCATGCATCTGAAA
JMFF004B12- GCTATTGCAACTTCATGCATCTGAAAAA
JMFF021A08- GCTATTGCAACTTCATGCATCTGAAAAA
JMFF041F23- GCTATTGCAACTTCATGCATCTGAAAAAGATTAGCAGAGAGCTGAGGCGG-CGGTTATTT
JMFS051E11- GCTATTGCAACTTCATGCATCTGAAAAAGATTAGCAGAGAGCTGAGGCGG-CAGTTATTT
JMFF041H10- GCTATTGCAACTTCATGCATCTGAAAAAGATTAGCAGAGAGCTGAGGCGG-CAGTTATTT
JMFN018I07+ GCTATTGCAACTTCATGCATCTGAAAAAGATTAGCAGAGAGCTGAGGCGG-CAGTTATTT
rJMFF021A08+ AAAAAGATTAGCAGAGAGCTGAGGCGG-CAGTTATTT
rJMFF024E20+ CATGCATCTGAAAAAGATTAGCAGAGAGCTGAGGCGG-CAGTTATTT
rJMFF007L12+ CATGCATNTGAAAAAGATTAGCAGAGAGNTGAGGCGG-CAGTTATTT
rJMSF014B16+ AACTTCATGCATTTGAAAAAGATTAGCAGAGAGCTGAGGCGGNCAGTTATTT
rJMFF018M03+ AAAGATTAGCAGAGAGCTGAGGC-GNCAGTTATTT
                      ____________________________________________________________
consensus GCTATTGCAACTTCATGCATCTGAAAAAGATTAGCAGAGAGCTGAGGCGG-CAGTTATTT
 
. : . : . : . : . : . :
JMFF041F23- GGGAAGAGCAGGCGA
JMFS051E11- G
JMFF041H10- GGGAAGAGCAGGCGAAGACGCAGCCATAGTAGAAGCAGAAGTCCTC
JMFN018I07+ GGGAAGAGCAGGCGAAGACGCAGCCATAGTAGAAGCAGAAGTCCTCGTGGTCATCATGGT
rJMFF021A08+ GGGAAGAGCAGGCGAAGACGCAGCCATAGTAGAAGCAGAAGTCCTCGTGGTCATCATGGT
rJMFF024E20+ GGGAAGAGCAGGCGAAGACGCAGCCATAGTAGAAGCAGAAGTCNTCGTGGTCATCATGGT
rJMFF007L12+ GGGAAGAGCAGGCGAAGACGCAGCCATAGTAGAAGCAGAAGTCCTCGTGGTCATCATGGT
rJMSF014B16+ GGGAAGAGCAGGCGAAGACGCAGCCATAGTAGAAGCAGAAGTCCTCGTGGTCATCATGGT
rJMFF014K10+ GAAGAGCAGGCGAAGACGCAGCCATAGTAGAAGCAGAAGTCNTCGTGGTCATCATGGT
rJMFF018M03+ GGGAAGAGCAGGCGAAGACGCAGCCATAGTAGAAGCAGAAGTCNTCGTGGTCATCATGGT
                      ____________________________________________________________
consensus GGGAAGAGCAGGCGAAGACGCAGCCATAGTAGAAGCAGAAGTCCTCGTGGTCATCATGGT
 
. : . : . : . : . : . :
JMFN018I07+ CATGATGAGCGGCCATATGGTGGCCGTGGATA
rJMFF021A08+ CATGATGAGCGGCCATATGGTGGCCGTGGATATCCTAGAAGAGGTGGCGATCATCGTCAC
rJMFF024E20+ CATGATGAGCGGCCATATGGTGGCCGTGGATATCCTAGAAGAGGTGGCGATCATCGTCAC
rJMFF007L12+ CATGATGAGCGGCCATATGGTGGCCGTGGATATCCTAGAAGAGGTGGCGATCATCGTCAC
rJMSF014B16+ CATGATGAGCGGCCATATGGTGGCCGTGGATATCCTAGAAGAGGTGGCGATCATCGTCAC
rJMFF019I23+ TAGAAGAGGTTGCGATCATCGTCAC
rJMFF014K10+ CATGATGAGCGGCCATATGGTGGCCGTGGATATCCTAGAAGAGGTGGCGATCATCGTCAC
rJMFF004B12+ TCCTAGAAGAGGTGGCGATCATCGTCAC
rJMFF018M03+ CATGATGAGCGGCCATATGGTGGCCGTGGATATCNTAGAAGAGGTGGCGATCATCGTCAC
                      ____________________________________________________________
consensus CATGATGAGCGGCCATATGGTGGCCGTGGATATCCTAGAAGAGGTGGCGATCATCGTCAC
 
. : . : . : . : . : . :
rJMFF021A08+ CATGAACGAGGGAGGAGACCACGAAGCAGAAGTCCTGGTAGAAGAAGTGGACATAGCAGA
rJMFF024E20+ CATGAACGAGGGAGGAGACCACGAAGCAGAAGTCCTGGTAGAAGAAGTGGACATAGCAGA
rJMFF040B13+ GAGGGAGGAGACCANGAAGCAGAAGTCNTGGTAGAAGAAGTGGACATAGCAGA
rJMFF007L12+ CATGAACGAGGGAGGAGACCACGAAGCAGAAGTCCTGGTAGAAGAAGTGGACATAGCAGA
rJMSF014B16+ CATGAACGAGGGAGGAGACCACGAAGCAGAAGTCCTGGTAGAAGAAGTGGACATAGCAGA
rJMFF019I23+ CATGAACGAGGGAGGAGACCACGAAGCAGAAGTCCTGGTAGAAGAAGTGGACATAGCAGA
rJMFF014K10+ CATGAACGAGGGAGGAGACCACGAAGCAGAAGTCCTGGTAGAAGAAGTGGACATAGCAGA
rJMFF004B12+ CATGAACGAGGGAGGAGACCACGAAGCAGAAGTCCTGGTAGAAGAAGTGGACATAGCAGA
rJMFF018M03+ CATGAACGAGGGAGGAGACCACGAAGCAGAAGTCCTGGTAGAAGAAGTGGACATAGCAGA
rJMFF005N12+ GAACGAGGGAGGAGACCACGAAGCAGAAGTCCTGGTAGAAGAAGTGGACATAGCAGA
                      ____________________________________________________________
consensus CATGAACGAGGGAGGAGACCACGAAGCAGAAGTCCTGGTAGAAGAAGTGGACATAGCAGA
 
. : . : . : . : . : . :
rJMFF021A08+ AGTCCTGGTGGTAGGAGAAATAGGAGTCCAGTCAGGGAAGGTAGTGCTGAGAGAAGGGCA
rJMFF024E20+ AGTCCTGGTGGTAGGAGAAATAGGAGTCCAGTCAGGGAAGGTAGTGCTGAGAGAAGGGCA
rJMFF040B13+ AGTCNNGGNGGTAGGAGAAATAGGAGTCCAGTCAGGGAAGGTAGTGNTGAGAGAAGGGCA
rJMFF007L12+ AGTCCTGGTGGTAGGAGAAATAGGAGTCCAGTCAGGGAAGGTAGTGCTGAGAGAAGGGCA
rJMSF014B16+ AGTCCTGGTGGTAGGAGAAATAGGAGTCCAGTCAGGGAAGGTAGTGCTGAGAGAAGGGCA
rJMFF019I23+ AGTCCTGGTGGTAGGAGAAATAGGAGTCCAGTCAGGGAAGGTAGTGCTGAGAGAAGGGCA
rJMFF014K10+ AGTCCTGGTGGTAGGAGAAATAGGAGTCCAGTCAGGGAAGGTAGTGCTGAGAGAAGGGCA
rJMFF004B12+ AGTCCTGGTGGTAGGAGAAATAGGAGTCCAGTCAGGGAAGGTAGTGCTGAGAGAAGGGCA
rJMFF018M03+ AGTCCTGGTGGTAGGAGAAATAGGAGTCCAGTCAGGGAAGGTAGTGCTGAGAGAAGGGCA
rJMFF005N12+ AGTCCTGGTGGTAGGAGAAATAGGAGTCCAGTCAGGGAAGGTAGTGCTGAGAGAAGGGCA
rJMFF041F23+ ATAGGAGTCCAGTCAGGGAAGGTAGTGCTGAGAGAAGGGCA
                      ____________________________________________________________
consensus AGTCCTGGTGGTAGGAGAAATAGGAGTCCAGTCAGGGAAGGTAGTGCTGAGAGAAGGGCA
 
. : . : . : . : . : . :
rJMFF021A08+ AAGATTGAACAATGGAATAGGGAAAGGGAACAACCTGACAAGAATGATAATAGTGGTATG
rJMFF024E20+ AAGATTGAACAATGGAATAGGGAAAGGGAACAACCTGACAAGAATGATAATAGTGGTATG
rJMFF040B13+ AAGATTGAACAATGGAATAGGGAAAGGGAACAACCTGACAAGAATGATAATAGTGGTATG
rJMFF007L12+ AAGATTGAACAATGGAATAGGGAAAGGGAACAACCTGACAAGAATGATAATAGTGGTATG
rJMSF014B16+ AAGATTGAACAATGGAATAGGGAAAGGGAACAACCTGACAAGAATGATAATAGTGGTATG
rJMFF019I23+ AAGATTGAACAATGGAATAGGGAAAGGGAACAACCTGACAAGAATGATAATAGTGGTATG
rJMFF014K10+ AAGATTGAACAATGGAATAGGGAAAGGGAACAACCTGACAAGAATGATAATAGTGGTATG
rJMFF004B12+ AAGATTGAACAATGGAATAGGGAAAGGGAACAACCTGACAAGAATGATAATAGTGGTATG
rJMFF018M03+ AAGATTGAACAATGGAATAGGGAAAGGGAACAACCTGACAAGAATGATAATAGTGGTATG
rJMFF005N12+ AAGATTGAACAATGGAATAGGGAAAGGGAACAACCTGACAAGGATGATAATAGTGGTATG
rJMFF041H10+ AAGATTGAACAATGGAATAGGGAAAGGGAACAACCTGACAAGAATGATAATAGTGGTATG
rJMFF041F23+ AAGATTGAACAATGGAATAGGGAAAGGGAACAACCTGACAAGAATGATAATAGTGGTATG
                      ____________________________________________________________
consensus AAGATTGAACAATGGAATAGGGAAAGGGAACAACCTGACAAGAATGATAATAGTGGTATG
 
. : . : . : . : . : . :
rJMFF021A08+ GTAAGGGAAGGTAGTGCTGAGAGAAGGGCAAAGATTGAGCAGTGGAATAGGGAAAGAGAA
rJMFF024E20+ GTAAGGGAAGGTAGTGCTGAGAGAAGGGCAAAGATTGAGCAGTGGAATAGGGAAAGAGAA
rJMFF040B13+ GTAAGGGAAGGTAGTGCTGAGAGAAGGGCAAAGATTGAGCAGTGGAATAGGGAAAGAGAA
rJMFF007L12+ GTAAGGGAAGGTAGTGCTGAGAGAAGGGCAAAGATTGAGCAGTGGAATAGGGAAAGAGAA
rJMSF014B16+ GTAAGGGAAGGTAGTGCTGAGAGAAGGGCAAAGATTGAGCAGTGGAATAGGGAAAGAGAA
rJMFF019I23+ GTAAGGGAAGGTAGTGCTGAGAGAAGGGCAAAGATTGAGCAGTGGAATAGGGAAAGAGAA
rJMFF014K10+ GTAAGGGAAGGTAGTGCTGAGAGAAGGGCAAAGATTGAGCAGTGGAATAGGGAAAGAGAA
rJMFF004B12+ GTAAGGGAAGGTAGTGCTGAGAGAAGGGCAAAGATTGAGCAGTGGAATAGGGAAAGAGAA
rJMFF018M03+ GTAAGGGAAGGTAGTGCTGAGAGAAGGGCAAAGATTGAGCAGTGGAATAGGGAAAGAGAA
rJMFF005N12+ GTAAGGGAAGGTAGTGCTGAGAGAAGGGCAAAGATTGAGCAGTGGAATAGGGAAAGAGAA
rJMFF041H10+ GTAAGGGAAGGTAGTGCTGAGAGAAGGGCAAAGATTGAGCAGTGGAATAGGGAAAGAGAA
rJMFF041F23+ GTAAGGGAAGGTAGTGCTGAGAGAAGGGCAAAGATTGAGCAGTGGAATAGGGAAAGAGAA
                      ____________________________________________________________
consensus GTAAGGGAAGGTAGTGCTGAGAGAAGGGCAAAGATTGAGCAGTGGAATAGGGAAAGAGAA
 
. : . : . : . : . : . :
rJMFF021A08+ CAGACTGATTCGGCTAAGAACAATGATGTTGGCACATTTGAAAATGGCAGTAGGAATGGT
rJMFF024E20+ CAGACTGATTCGGCTAAGAACAATGATGTTGGCACATTTGAAAATGGCAGTAGGAATGGT
rJMFF040B13+ CAGACTGATTCGGNTAAGAACAATGATGTTGGCACATTTGAAAATGGCAGTAGGAATGGT
rJMFF007L12+ CAGACTGATTCGGCTAAGAACAATGATGTTGGCACATTTGAAAATGGCAGTAGGAATGGT
rJMSF014B16+ CAGACTGATTCGGCTAAGAACAATGATGTTGGCACATTTGAAAATGGCAGTAGGAATGGT
rJMFF019I23+ CAGACTGATTCGGCTAAGAACAATGATGTTGGCACATTTGAAAATGGCAGTAGGAATGGT
rJMFF014K10+ CAGACTGATTCGGCTAAGAACAATGATGTTGGCACATTTGAAAATGGCAGTAGGAATGGT
rJMFF004B12+ CAGACTGATTCGGCTAAGAACAATGATGTTGGCACATTTGAAAATGGCAGTAGGAATGGT
rJMFF018M03+ CAGACTGATTCGGCTAAGAACAATGATGTTGGCACATTTGAAAATGGCAGTAGGAATGGT
rJMFF005N12+ CAGACTGATTCGGCTAAGAACAATGATGTTGGCACATTTGAAAATGGCAGTAGGAATGGT
rJMFF041H10+ CAGACTGATTCGGCTAAGAACAATGATGTTGGCACATTTGAAAATGGCAGTAGGAATGGT
rJMFF041F23+ CAGACTGATTCGGCTAAGAACAATGATGTTGGCACATTTGAAAATGGCAGTAGGAATGGT
                      ____________________________________________________________
consensus CAGACTGATTCGGCTAAGAACAATGATGTTGGCACATTTGAAAATGGCAGTAGGAATGGT
 
. : . : . : . : . : . :
rJMFF021A08+ GCTGAGCACCACCCAGAACAGTTTTATGATGATTATCAGCAGCAGCAATAGCTGGAGATA
rJMFF024E20+ GCTGAGCACCACCCAGAACAGTTTTATGATGATTATCAGCAGCAGCAATAGCTGGAGATA
rJMFF040B13+ GCTGAGCACCACCCAGAACAGTTTTATGATGATTATCAGCAGCAGCAATAGCTGGAGATA
rJMFF007L12+ GCTGAGCACCACCCAGAACAGTTTTATGATGATTATCAGCAGCAGCAATAGCTGGAGATA
rJMSF014B16+ GCTGAGCACCACCCAGAACAGTTTTATGATGATTATCAGCAGCAGCAATAGCTGGAGATA
rJMFF019I23+ GCTGAGCACCACCCAGAACAGTTTTATGATGATTATCAGCAGCAGCAATAGCTGGAGATA
rJMFF014K10+ GCTGAGCACCACCCAGAACAGTTTTATGATGATTATCAGCAGCAGCAATAGCTGGAGATA
rJMFF004B12+ GCTGAGCACCACCCAGAACAGTTTTATGATGATTATCAGCAGCAGCAATAGCTGGAGATA
rJMFF018M03+ GCTGAGCACCACCCAGAACAGTTTTATGATGATTATCAGCAGCAGCAATAGCTGGAGATA
rJMFF005N12+ GCTGAGCACCACCCAGAACAGTTTTATGATGATTATCAGCAGCAGCAATAGCTGGAGATA
rJMFF041H10+ GCTGAGCACCACCCAGAACAGTTTTATGATGATTATCAGCAGCAGCAATAGCTGGAGATA
rJMFF041F23+ GCTGAGCACCACCCAGAACAGTTTTATGATGATTATCAGCAGCAGCAATAGCTGGAGATA
                      ____________________________________________________________
consensus GCTGAGCACCACCCAGAACAGTTTTATGATGATTATCAGCAGCAGCAATAGCTGGAGATA
 
. : . : . : . : . : . :
rJMFF021A08+ TTCCAGAAAACTACTGGTTGGCTGTCTTCTTTGCAGAACAGGTCCACAGGATTTAAATGT
rJMFF024E20+ TTCCAGAAAACTACTGGTTGGCTGTCTTCTTTGCAGAACAGGTCCACAGGATTTAAATGT
rJMFF040B13+ TTCCAGAAAACTACTGGTTGGCTGTCTTCTTTGCAGAACAGGTCCACAGGATTTAAATGT
rJMFF007L12+ TTCCAGAAAACTACTGGTTGGCTGTCTTCTTTGCAGAACAGGTCCACAGGATTTAAATGT
rJMSF014B16+ TTCCAGAAAACTACTGGTTGGCTGTCTTCTTTGCAGAACAGGTCCACAGGATTTAAATGT
rJMFF019I23+ TTCCAGAAAACTACTGGTTGGCTGTCTTCTTTGCAGAACAGGTCCACAGGATTTAAATGT
rJMFF014K10+ TTCCAGAAAACTACTGGTTGGCTGTCTTCTTTGCAGAACAGGTCCACAGGATTTAAATGT
rJMFF004B12+ TTCCAGAAAGCTACTGGTTGGCTGTCTTCTTTGCAGAACAGGTCCACAGGATTTAAATGT
rJMFF018M03+ TTCCAGAAAACTACTGGTTGGCTGTCTTCTTTGCAGAACAGGTCCACAGGATTTAAATGT
rJMFF005N12+ TTCCAGAAAACTACTGGTTGGCTGTCTTCTTTGCAGAACAGGTCCACAGGATTTAAATGT
rJMFF041H10+ TTCCAGAAAACTACTGGTTGGCTGTCTTCTTTGCAGAACAGGTCCACAGGATTTAAATGT
rJMFF041F23+ TTCCAGAAAACTACTGGTTGGCTGTCTTCTTTGCAGAACAGGTCCACAGGATTTAAATGT
                      ____________________________________________________________
consensus TTCCAGAAAACTACTGGTTGGCTGTCTTCTTTGCAGAACAGGTCCACAGGATTTAAATGT
 
. : . : . : . : . : . :
rJMFF021A08+ GTGATGTAAGGAGAAGTGAAGGAACTGTCTACTTTCAAACATGTCAAGTGCTAATGTCTG
rJMFF024E20+ GTGATGTAAGGAGAAGTGAAGGAACTGTCTACTTTCAAACATGTCAAGTGCTAATGTCTG
rJMFF040B13+ GTGATGTAAGGAGAAGTGAAGGAACTGTCTACTTTCAAACATGTCAAGTGCTAATGTCTG
rJMFF007L12+ GTGATGTAAGGAGAAGTGAAGGAACTGTCTACTTTCAAACATGTCAAGTGCTAATGTCTG
rJMSF014B16+ GTGATGTAAGGAGAAGTGAAGGAACTGTCTACTTTCAAACATGTCAAGTGCTAATGTCTG
rJMFF019I23+ GTGATGTAAGGAGAAGTGAAGGAACTGTCTACTTTCAAACATGTCAAGTGCTAATGTCTG
rJMFF014K10+ GTGATGTAAGGAGAAGTGAAGGAACTGTCTACTTTCAAACATGTCAAGTGCTAATGTCTG
rJMFF004B12+ GTGATGTAAGGAGAAGTGAAGGAACTGTCTACTTTCAAACATGTCAAGTGCTAATGTCTG
rJMFF018M03+ GTGATGTAAGGAGAAGTGAAGGAACTGTCTACTTTCAAACATGTCAAGTGCTAATGTCTG
rJMFF005N12+ GTGATGTAAGGAGAAGTGAAGGAACTGTCTACTTTCAAACATGTCAAGTGCTAATGTCTG
rJMFF041H10+ GTGATGTAAGGAGAAGTGAAGGAACTGTCTACTTTCAAACATGTCAAGTGCTAATGTCTG
rJMFF041F23+ -TGATGTAAGGAGAAGTGAAGGAACTGTCTACTTTCAAACATGTCAAGTGCTAATGTCTG
                      ____________________________________________________________
consensus GTGATGTAAGGAGAAGTGAAGGAACTGTCTACTTTCAAACATGTCAAGTGCTAATGTCTG
 
. : . : . : . : . : . :
rJMFF021A08+ CTTTCTAGAGAGCTAAAGGTTGCAACCCAGAATTCAATTCGATCCTATTTGTGTTGACCT
rJMFF024E20+ CTTTCTAGAGAGCTAAAGGTTGCAACCCAGAATTCAATTCGATCCTATTTGTGTTGACCT
rJMFF040B13+ CTTTCTAGAGAGCTAAAGGTTGCAACCCAGAATTCAATTCGATCCTATTTGTGTTGACCT
rJMFF007L12+ CTTTCTAGAGAGCTAAAGGTTGCAACCCAGAATTCAATTCGATCCTATTTGTGTTGACCT
rJMSF014B16+ CTTTCTAGAGAGCTAAAGGTTGCAACCCAGAATTCAATTCGATCCTATTTGTGTTGACCT
rJMFF019I23+ CTTTCTAGAGAGCTAAAGGTTGCAACCCAGAATTCAATTCGATCCTATTTGTGTTGACCT
rJMFF014K10+ CTTTCTAGAGAGCTAAAGGTTGCAACCCAGAATTCAATTCGATCCTATTTGTGTTGACCT
rJMFF004B12+ CTTTCTAGAGAGCTAAAGGTTGCAACCCAGAATTCAATTCGATCCTATTTGTGTTGACCT
rJMFF018M03+ CTTTCTAGAGAGCTAAAGGTTGCAACCCAGAATTCAATTCGATCCTATTTGTGTTGACCT
rJMFF005N12+ CTTTCTAGAGAGCTAAAGGTTGCAACCCAGAATTCAATTCGATCCTATTTGTGTTGACCT
rJMFF041H10+ CTTTCTAGAGAGCTAAAGGTTGCAACCCAGAATTCAATTCGATCCTATTTGTGTTGACCT
rJMFF041F23+ CTTTCTAGAGAGCTAAAGGTTGCAACCCAGAATTCAATTCGATCCTATTTGTGTTGACCT
                      ____________________________________________________________
consensus CTTTCTAGAGAGCTAAAGGTTGCAACCCAGAATTCAATTCGATCCTATTTGTGTTGACCT
 
. : . : . : . : . : . :
rJMFF021A08+ TGCTTATGTTGTATTGTCTTTTTGAATTTTGTTGTTTCATAATGTTCTTGGATTGA-GCA
rJMFF024E20+ TGCTTATGTTGTATTGTCTTTTTGAATTTTGTTGTTTCATAATGTTCTTGGATTGA
rJMFF040B13+ TGCTTATGTTGTATTGTCTTTTTGAATTTTGTTGTTTCATA
rJMFF007L12+ TGCTTATGTTGTATTGTCTTTTTGAATTTTGTTGTTTCATAATGTTCTTGGATTGATGCA
rJMSF014B16+ TGCTTATGTTGTATTGTCTTTTTGAATTTTGTTGTTTCATAATGTTCTTGGATTGATGCA
rJMFF019I23+ TGCTTATGTTGTATTGTCTTTTTGAATTTTGTTGTTTCATAATGTTCTTGGATTGATGCA
rJMFF014K10+ TGCTTATGTTGTATTGTCTTTTTGAATTTTGTTGTTTCATAATGTTCTTGGATTGATGCA
rJMFF004B12+ TGCTTATGTTGTATTGTCTTTTTGAATTTTGTTGTTTCATAATGTTCTTGGATTGATGCA
rJMFF018M03+ TGCTTATGTTGTATTGTCTTTTTGAATTTTGTTGTTTCATAATGTTCTTGGATTGATGCA
rJMFF005N12+ TGCTTATGTTGTATTGTCTTTTTGAATTTTGTTGTTTCATAATGTTCTTGGATTGATGCA
rJMFF041H10+ TGCTTATGTTGTATTGTCTTTTTGAATTTTGTTGTTTCATAATGTTCTTGGATTGATGCA
rJMFF041F23+ TGCTTATGTTGTATTGTCTTTTTGAATTTTGTTGTTTCATAATGTTCTTGGATTGATGCA
                      ____________________________________________________________
consensus TGCTTATGTTGTATTGTCTTTTTGAATTTTGTTGTTTCATAATGTTCTTGGATTGATGCA
 
. : . : . : . : . : . :
rJMFF021A08+ TAAAAGAT
rJMFF007L12+ TAAAAGAT
rJMSF014B16+ TAAAAGATTGTTATGTTTTCATAGTATCCCTTTATGCTTTGTTGGATTGAAACTGTATTA
rJMFF019I23+ TAAAAGATTGTTATGTTTTCATAGTATCCCTTTATGCTTTGTTGGATTGAAACTGTATTA
rJMFF014K10+ TAAAAGATTGTTATGTTTTCATAGTATCCCTTTATGCTTTGTTGGATTGAAACTGTATTA
rJMFF004B12+ TAAAAGATTGTTATGTTTTCATAGTATCCCTTTATGCTTTGTTGGATTGAAACTGTATTA
rJMFF018M03+ TAAAAGATTGTTATGTTTTCATAGTATCCCTTTATGCTTTGTTGGATTGAAACTGTATTA
rJMFF005N12+ TAAAAGATTGTTATGTTTTCATAGTATCCCTTTATGCTTTGTTGGATTGAAACTGTATTA
rJMFF041H10+ TAAAAGATTGTTATGTTTTCATAGTATCCCTTTATGCTTTGTTGGATTGAAACTGTATTA
rJMFF041F23+ TAAAAGATTGTTATGTCTTCATAGTATCCCTTTATGCTTTGTTGGATTGAAACTGTATTA
                      ____________________________________________________________
consensus TAAAAGATTGTTATGTTTTCATAGTATCCCTTTATGCTTTGTTGGATTGAAACTGTATTA
 
. : . : . : . : . : . :
rJMSF014B16+ TTAAGTAATACTGGCTG
rJMFF019I23+ TTAAGTAATACTGGCTGTGGCTTTGCAAGT
rJMFF014K10+ TTAAGTAATACTGGCTGTGGCTTTGCAAGT
rJMFF004B12+ TTAAGTAATACTGGCTGTGGCTTTGCAAGT
rJMFF018M03+ TTAAGTAATACTGGCTGTGGCTTTGCAAGTGTTTT
rJMFF005N12+ TTAAGTAATACTGGCTGTGGCTTTGCAAGTGTTTTAA
rJMFF041H10+ TTAAGTAATACTGGCTGTGGCTTTGCAAGTGTTTTAATGTTTTAAAGTGAAATTCTTAGC
rJMFF041F23+ TTAAGTAATACTGGCTGTGGCTTTGCAAGTGTTTTAATGTTTTAAAGTGAAATTCTTAGC
                      ____________________________________________________________
consensus TTAAGTAATACTGGCTGTGGCTTTGCAAGTGTTTTAATGTTTTAAAGTGAAATTCTTAGC