Previous Contig 010125:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022G09Sequence465001114 (3)pir|T49208|T492081e-13hypothetical protein F27K19.140 - Arabidopsis thaliana>gb:ATF27K19_1550241 Arabi788010125 (2)gb:AP004366_18408451e-49Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P046
JMFF041F12Sequence657001114 (3)pir|T49208|T492085e-44hypothetical protein F27K19.140 - Arabidopsis thaliana>gb:ATF27K19_1550241 Arabi604010125 (2)gb:AP004366_18408452e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P046

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF022G09+ AGAACTCAGCAAATTTGCTGACCTTGTGTTAT
                      ____________________________________________________________
consensus AGAACTCAGCAAATTTGCTGACCTTGTGTTAT
 
. : . : . : . : . : . :
rJMFF022G09+ TTACTGCTGGACTTGAAGGATATGCAAGGCCAGTTGTTGATAAATTGGATGTTGATCACC
                      ____________________________________________________________
consensus TTACTGCTGGACTTGAAGGATATGCAAGGCCAGTTGTTGATAAATTGGATGTTGATCACC
 
. : . : . : . : . : . :
rJMFF022G09+ TATTTATTCATCGGCTTTACAGGCCTTCAACGACCAGCACTGAATATCGGGAGCATGTGA
                      ____________________________________________________________
consensus TATTTATTCATCGGCTTTACAGGCCTTCAACGACCAGCACTGAATATCGGGAGCATGTGA
 
. : . : . : . : . : . :
rJMFF022G09+ AGGATCTATCTTGCATTTCAAAAGATTTAAGCCGAATTGTTATGGTTGATAACAACCCTT
rJMFF041F12+ CCTT
                      ____________________________________________________________
consensus AGGATCTATCTTGCATTTCAAAAGATTTAAGCCGAATTGTTATGGTTGATAACAACCCTT
 
. : . : . : . : . : . :
rJMFF022G09+ TCAGTTTTTTACTGCAACCATTGAATGGAATTCCTTGCGTTCCTTTTTCTGCAGGACAGC
rJMFF041F12+ TCAGTTTTTTACTGCAACCATTGAATGGAATTCCTTGCGTTCCTTTTTCTGCAGGACAGC
                      ____________________________________________________________
consensus TCAGTTTTTTACTGCAACCATTGAATGGAATTCCTTGCGTTCCTTTTTCTGCAGGACAGC
 
. : . : . : . : . : . :
rJMFF022G09+ CTCACGATGAGCAGCTTCTGGAAGTTATCCTTCCTCTTCTCGAGCATCTTTCTCAACAGA
rJMFF041F12+ CTCACGATGAGCAGCTTCTGGAAGTTATCCTTCCTCTTCTCGAGCATCTTTCTCAACAGA
                      ____________________________________________________________
consensus CTCACGATGAGCAGCTTCTGGAAGTTATCCTTCCTCTTCTCGAGCATCTTTCTCAACAGA
 
. : . : . : . : . : . :
rJMFF022G09+ AAGATGTACGTCCAGTGCTTTATGAAACGTTCCACATGCCTGAATGGTTTCAGAAGCACG
rJMFF041F12+ AAGATGTACGTCCAGTGCTTTATGAAACGTTCCACATGCCTGAATGGTTTCAGAAGCACG
                      ____________________________________________________________
consensus AAGATGTACGTCCAGTGCTTTATGAAACGTTCCACATGCCTGAATGGTTTCAGAAGCACG
 
. : . : . : . : . : . :
rJMFF022G09+ GAATCCCTGCTTCTAGAGCAATGAACGAGGGATGAGAATGAGATTACCCTCCATCCGAAA
rJMFF041F12+ GAATCCCTGCTTCTAGAGCAATGAACGAGGGATGAGAATGAGATTACCCTCCATCCGAAA
                      ____________________________________________________________
consensus GAATCCCTGCTTCTAGAGCAATGAACGAGGGATGAGAATGAGATTACCCTCCATCCGAAA
 
. : . : . : . : . : . :
rJMFF022G09+ AGCAGATTTTTGTATAGTACCGAGCGTTGTTGCTATCTGCGCAAAGGATCAGCCTTTAAG
rJMFF041F12+ AGCAGATTTTTGTATAGTACCGAGCGTTGTTGCTATCTGCGCAAAGGATCAGCCTTTAAG
                      ____________________________________________________________
consensus AGCAGATTTTTGTATAGTACCGAGCGTTGTTGCTATCTGCGCAAAGGATCAGCCTTTAAG
 
. : . : . : . : . : . :
rJMFF022G09+ CCTGAACAGAAAGGCCTCTCGTGCCACTTCGTTTGTATGTTCAACTGCTGTAGAGGCTCC
rJMFF041F12+ CCTGAACAGAAAGGCCTCTCGTGCCACTTCGTTTGTATGTTCAACTGCTGTAGAGGCTCC
                      ____________________________________________________________
consensus CCTGAACAGAAAGGCCTCTCGTGCCACTTCGTTTGTATGTTCAACTGCTGTAGAGGCTCC
 
. : . : . : . : . : . :
rJMFF022G09+ CGGAGTTGTGGATCCCTGTCGTGCTGCCCGGAAGAAGATCCAGAACTGTTGTAAGTGTAA
rJMFF041F12+ CGGAGTTGTGGATCCCTGTCGTGCTGCCCGGAAGAAGATCCAGAACTGTTGTAAGTGTAA
                      ____________________________________________________________
consensus CGGAGTTGTGGATCCCTGTCGTGCTGCCCGGAAGAAGATCCAGAACTGTTGTAAGTGTAA
 
. : . : . : . : . : . :
rJMFF022G09+ CATGGCTTGCCAATAAGTGTTCTTTCTTACAGAATAGATTAGTGAAAGAGAGTAGAAGAC
rJMFF041F12+ CATGGCTTGCCAATAAGTGTTCTTTCTTACAGAATAGATTAGTGAAAGAGAGTAGAAGAC
                      ____________________________________________________________
consensus CATGGCTTGCCAATAAGTGTTCTTTCTTACAGAATAGATTAGTGAAAGAGAGTAGAAGAC
 
. : . : . : . : . : . :
rJMFF022G09+ AGACAGGATGATGATGTTCGGAGAAGTTGAGGTTGTTCTGAAACAAAGCCATGTGTCCTA
rJMFF041F12+ AGACAGGATGATGATGTTCGGAGAAGTTGAGGTTGTTCTGAAACAAAGCCATGTGTCCTA
                      ____________________________________________________________
consensus AGACAGGATGATGATGTTCGGAGAAGTTGAGGTTGTTCTGAAACAAAGCCATGTGTCCTA
 
. : . : . : . : . : . :
rJMFF022G09+ AAGCTGGATGATGTATACAAAAGAAAGGGCATATCC
rJMFF041F12+ AAGCTGGATGATGTATACAAAAGAAAGGGCATATCCATGTTTTTCATGCTTTGCCTACTT
                      ____________________________________________________________
consensus AAGCTGGATGATGTATACAAAAGAAAGGGCATATCCATGTTTTTCATGCTTTGCCTACTT