Previous Contig 010124:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041F09Sequence657010124 (8)pir|T47701|T477013e-74translation initiation factor eIF-6-like protein [imported] - Arabidopsis thalia637010124 (8)gb:AP005292_18500081e-77Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ13
JMSF001G23Sequence190010124 (8)778010124 (8)gb:AP005292_1850008e-104Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ13
JMSF018I10Sequence546010124 (8)pir|T47701|T477011e-61translation initiation factor eIF-6-like protein [imported] - Arabidopsis thalia768010124 (8)gb:AP005292_18500085e-99Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ13
JMSF038G22Sequence667010124 (8)pir|T47701|T477012e-84translation initiation factor eIF-6-like protein [imported] - Arabidopsis thalia816010124 (8)gb:AP005292_1850008e-116Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ13

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF001G23- GGGGACATCACTAGTCTTCGTCGCTCCACCGTTACCGACGCTGCCGCC
JMSF018I10- ACATCACTAGTCTTCGTCGCTCCACCGTTACCGACGCTGCCGCC
JMFF041F09- ACATCACTAGTCTTCGTCGCTCCACCGTTACCGACGCTGCCGCC
JMSF038G22- ACATCACTAGTCTTCGTCGCTCCACCGTTACCGACGCTGCCGCC
                      ____________________________________________________________
consensus GGGGACATCACTAGTCTTCGTCGCTCCACCGTTACCGACGCTGCCGCC
 
. : . : . : . : . : . :
JMSF001G23- GCCACCACCACCACCGCTACCGTTCGGCCTGTTTAGGAATTTCAGGCACTCTCTGAGAAA
JMSF018I10- GCCACCACCACCACCGCTACCGTTCGGCCTGTTTAGGAATTTCAGGCACTCTCTGAGAAA
JMFF041F09- GCCACCACCACCACCGCTACCGTTCGGCCTGTTTAGGAATTTCAGGCACTCTCTGAGAAA
JMSF038G22- GCCACCACCACCACCGCTACCGTTCGGCCTGTTTAGGAATTTCAGGCACTCTCTGAGAAA
                      ____________________________________________________________
consensus GCCACCACCACCACCGCTACCGTTCGGCCTGTTTAGGAATTTCAGGCACTCTCTGAGAAA
 
. : . : . : . : . : . :
JMSF001G23- GCGATTACACTGAAAAAGTCCTTTTTGACAAGGAAAAAGCTGCTCGTTTTGTCCTTACCA
JMSF018I10- GCGATTACACTGAAAAAGTCCTTTTTGACAAGGAAAAAGCTGCTCGTTTTGTCCTTACCA
JMFF041F09- GCGATTACACTGAAAAAGTCCTTTTTGACAAGGAAAAAGCTGCTCGTTTTGTCCTTACCA
JMSF038G22- GCGATTACACTGAAAAAGTCCTTTTTGACAAGGAAAAAGCTGCTCGTTTTGTCCTTACCA
                      ____________________________________________________________
consensus GCGATTACACTGAAAAAGTCCTTTTTGACAAGGAAAAAGCTGCTCGTTTTGTCCTTACCA
 
. : . : . : . : . : . :
JMSF001G23- TGGCAACTAGGTTGCAGTTCGA
JMSF018I10- TGGCAACTAGGTTGCAGTTCGAGAATTCATGTGAAATTGGGGTCTTCTCCAAGCTGACAA
JMFF041F09- TGGCAACTAGG-TGCAGTTCGAGAATTCATGTGAAATTGGGGTCTTCTCCAAGCTGACAA
JMSF038G22- TGGCAACTAGGTTGCAGTTCGAGAATTCATGTGAAATTGGGGTCTTCTCCAAGCTGACAA
rJMSF038G22+ AGCTGACAA
                      ____________________________________________________________
consensus TGGCAACTAGGTTGCAGTTCGAGAATTCATGTGAAATTGGGGTCTTCTCCAAGCTGACAA
 
. : . : . : . : . : . :
JMSF018I10- ACGCTTACTGCTTGGTCGCAATTGGTGGATCAGAAAACTTTTACAGCACGTTT-GAAGCT
JMFF041F09- ACGCTTACTGCTTGGTCACAATTGGTGGATCAGAAAACTTTTACAGCACGTTT-GAAGCT
JMSF038G22- ACGCTTACTGCTTGGTCGCAATTGGTGGATCAGAAAACTTTTACAGCACGTTT-GAAGCT
rJMSF038G22+ ACGCTTACTGCTTGGTCGCAATTGGTGGATCAGAAAACTTTTACAGCACGTTT-GAAGCT
rJMSF018I10+ TTTACAGCACGTT--GAAGCT
rJMSF001G23+ AAAACTTTTACAGCACGTTTGNAAGCT
                      ____________________________________________________________
consensus ACGCTTACTGCTTGGTCGCAATTGGTGGATCAGAAAACTTTTACAGCACGTTT-GAAGCT
 
. : . : . : . : . : . :
JMSF018I10- GAGTTAGCAGATGCCATTCCAGTTATTAAAACCTCCATAGGTGGAACCCGGATAGTTGGA
JMFF041F09- GAGTTAGCAGATGCCATTCCAGTTATTAAAACCTCCATAGGTGGAACCCGGATAGTTGGA
JMSF038G22- GAGTTAGCAGATGCCATTCCAGTTATTAAAACCTCCATAGGTGGAACCCGGATAGTTGGA
rJMSF038G22+ GAGTTAGCAGATGCCATTCCAGTTATTAAAACCTCCATAGGTGGAACCCGGATAGTTGGA
rJMSF018I10+ GAGTTAGCAGATGCCATTCCAGTTATTAAAACCTCCATAGGTGGAACCCGGATAGTTGGA
rJMSF001G23+ GAGTTAGCAGATGCCATTCCAGTTATTAAAACCTCCATAGGTGGAACCCGGATAGTTGGA
                      ____________________________________________________________
consensus GAGTTAGCAGATGCCATTCCAGTTATTAAAACCTCCATAGGTGGAACCCGGATAGTTGGA
 
. : . : . : . : . : . :
JMSF018I10- CGGCTTTGTGCTGGAAACAAAAATGGTCTTATTCTGCCTCATACTACTACTGACCAAGAG
JMFF041F09- CGGCTTTGTGCTGGAAACAAAAATGGTCTTATTCTGCCTCATACTACTACTGACCAAGAG
JMSF038G22- CGGCTTTGTGCTGGAAACAAAAATGGTCTTATTCTGCCTCATACTACTACTGACCAAGAG
rJMSF038G22+ CGGCTTTGTGCTGGAAACAAAAATGGTCTTATTCTGCCTCATACTACTACTGACCAAGAG
rJMSF018I10+ CGGCTTTGTGCTGGAAACAAAAATGGTCTTATTCTGCCTCATACTACTACTGACCAAGAG
rJMSF001G23+ CGGCTTTGTGCTGGAAACAAAAATGGTCTTATTCTGCCTCATACTACTACTGACCAAGAG
                      ____________________________________________________________
consensus CGGCTTTGTGCTGGAAACAAAAATGGTCTTATTCTGCCTCATACTACTACTGACCAAGAG
 
. : . : . : . : . : . :
JMSF018I10- CTTCAACACTTGAGAAACAGTTTGCCAGATAGTGTTGTTGTTCAGCGTGCTGATGAGAGG
JMFF041F09- CTTCAACACTTGAGAAACAGTTTGCCAGATAGTGTTGTTGTTCAGCGTGCTGATGAGAGG
JMSF038G22- CTTCAACACTTGAGAAACAGTTTGCCAGATAGTGTTGTTGTTCAGCGTGCTGATGAGAGG
rJMSF038G22+ CTTCAACACTTGAGAAACAGTTTGCCAGATAGTGTTGTTGTTCAGCGTGCTGATGAGAGG
rJMSF018I10+ CTTCAACACTTGAGAAACAGTTTGCCAGATAGTGTTGTTGTTCAGCGTGCTGATGAGAGG
rJMSF001G23+ CTTCAACACTTGAGAAACAGTTTGCCAGATAGTGTTGTTGTTCAGCGTGCTGATGAGAGG
rJMFF041F09+ GCCAGATAGTGTTGTTGTTCAGCGTGCTGATGAGAGG
                      ____________________________________________________________
consensus CTTCAACACTTGAGAAACAGTTTGCCAGATAGTGTTGTTGTTCAGCGTGCTGATGAGAGG
 
. : . : . : . : . : . :
JMSF018I10- CTATCCGCTTTGGGAAACTGCATTGCTTGCAATGACCATGTTGCTCTTACGCACACTGAT
JMFF041F09- CTATCCGCTTTGGGAAACTGCATTGCTTGCAATGACCATGTTGCTCTTACGCACACTGAT
JMSF038G22- CTATCCGCTTTGGGAAACTGCATTGCTTGCAATGACCATGTTGCTCTTACGCACACTGAT
rJMSF038G22+ CTATCCGCTTTGGGAAACTGCATTGCTTGCAATGACCATGTTGCTCTTACGCACACTGAT
rJMSF018I10+ CTATCCGCTTTGGGAAACTGCATTGCTTGCAATGACCATGTTGCTCTTACGCACACTGAT
rJMSF001G23+ CTATCCGCTTTGGGAAACTGCATTGCTTGCAATGACCATGTTGCTCTTACGCACACTGAT
rJMFF041F09+ CTATCCGCTTTGGGAAACTGCATTGCTTGCAATGACCATGTTGCTCTTACGCACACTGAT
                      ____________________________________________________________
consensus CTATCCGCTTTGGGAAACTGCATTGCTTGCAATGACCATGTTGCTCTTACGCACACTGAT
 
. : . : . : . : . : . :
JMSF018I10- CTTGATAGGGAAACTGAAG
JMFF041F09- CTTGATAGGGAAACTGAAGAGTTGATTGCGGATGTTCTCGGAGTTGAAGTCTTTAGGCAG
JMSF038G22- CTTGATAGGGAAACTGAAGAGTTGATTGCGGATGTTCTCGGAGTTGAAGTCTTTAGGCAG
rJMSF038G22+ CTTGATAGGGAAACTGAAGAGTTGATTGCGGATGTTCTCGGAGTTGAAGTCTTTAGGCAG
rJMSF018I10+ CTTGATAGGGAAACTGAAGAGTTGATTGCGGATGTTCTCGGAGTTGAAGTCTTTAGGCAG
rJMSF001G23+ CTTGATAGGGAAACTGAAGAGTTGATTGCGGATGTTCTCGGAGTTGAAGTCTTTAGGCAG
rJMFF041F09+ CTTGATAGGGAAACTGAAGAGTTGATTGCGGATGTTCTCGGAGTTGAAGTCTTTAGGCAG
                      ____________________________________________________________
consensus CTTGATAGGGAAACTGAAGAGTTGATTGCGGATGTTCTCGGAGTTGAAGTCTTTAGGCAG
 
. : . : . : . : . : . :
JMFF041F09- ACAATAGCTGGGAATATACTTGTTGGCAGCTATTGTGCTTTTTCT-ACAGAGGTGGCTTG
JMSF038G22- ACAATAGCTGGGAATATACTTGTTGGCAGCTATTGTGCTTTTTCTAACAGAGGTGGCTTG
rJMSF038G22+ ACAATAGCTGGGAATATACTTGTTGGCAGCTATTGTGCTTTTTCTAACAGAGGTGGCTTG
rJMSF018I10+ ACAATAGCTGGGAATATACTTGTT--CAGCTATTGTGCTTTTTCTAACAGAGGTGGCTTG
rJMSF001G23+ ACAATAGCTGGGAATATACTTGTTGGCAGCTATTGTGCTTTTTCTAACAGAGGTGGCTTG
rJMFF041F09+ ACAATAGCTGGGAATATACTTGTTGGCAGCTATTGTGCTTTTTCTAACAGAGGTGGCTTG
                      ____________________________________________________________
consensus ACAATAGCTGGGAATATACTTGTTGGCAGCTATTGTGCTTTTTCTAACAGAGGTGGCTTG
 
. : . : . : . : . : . :
JMFF041F09- GTGCATCCTCATA
JMSF038G22- GTGCATCCTCATACATCCGTC
rJMSF038G22+ GTGCATCCTCATACATCCGTCGAAGACTTGGATGAACTTTCGACGCTCCTCCAGGTTCCT
rJMSF018I10+ GTGCATCCTCATACATCCGTCGAAGACTTGGATGAACTTTCGACGCTCCTCCAGGTTCCT
rJMSF001G23+ GTGCATCCTCATACATCCGTCGAAGACTTGGATGAACTTTCGACGCTCCTCCAGGTTCCT
rJMFF041F09+ GTGCATCCTCATACATCCGTCGAAGACTTGGATGAACTTTCGACGCTCCTCCAGGTTCCT
                      ____________________________________________________________
consensus GTGCATCCTCATACATCCGTCGAAGACTTGGATGAACTTTCGACGCTCCTCCAGGTTCCT
 
. : . : . : . : . : . :
rJMSF038G22+ CTGGTGGCCGGAACTGTGAACCGAGGTAGTGACGTGATTGCTGCTGGATTGACAGTCAAC
rJMSF018I10+ CTGGTGGCCGGAACTGTGAACCGAGGTAGTGACGTGATTGCTGCTGGATTGACAGTCAAC
rJMSF001G23+ CTGGTGGCCGGAACTGTGAACCGAGGTAGTGACGTGATTGCTGCTGGATTGACAGTCAAC
rJMFF041F09+ CTGGTGGCCGGAACTGTGAACCGAGGTAGTGACGTGATTGCTGCTGGATTGACAGTCAAC
                      ____________________________________________________________
consensus CTGGTGGCCGGAACTGTGAACCGAGGTAGTGACGTGATTGCTGCTGGATTGACAGTCAAC
 
. : . : . : . : . : . :
rJMSF038G22+ GACTGGACCGCGTTTTGTGGCTCTGACACTACCGCAACGGAGTTGTCTGTCATCGAGAGC
rJMSF018I10+ GACTGGACCGCGTTTTGTGGCTCTGACACTACCGCAACGGAGTTGTCTGTCATCGAGAGC
rJMSF001G23+ GACTGGACCGCGTTTTGTGGCTCTGACACTACCGCAACGGAGTTGTCTGTCATCGAGAGC
rJMFF041F09+ GACTGGACCGCGTTTTGTGGCTCTGACACTACCGCAACGGAGTTGTCTGTCATCGAGAGC
                      ____________________________________________________________
consensus GACTGGACCGCGTTTTGTGGCTCTGACACTACCGCAACGGAGTTGTCTGTCATCGAGAGC
 
. : . : . : . : . : . :
rJMSF038G22+ GTTTTCAAGCTGAGAGAGGCTCAGCCAAGCGCTATCGTCGATGAAATGCGGAAATCGTTG
rJMSF018I10+ GTTTTCAAGCTGAGAGAGGCTCAGCCAAGCGCTATCGTCGATGAAATGCGGAAATCGTTG
rJMSF001G23+ GTTTTCAAGCTGAGAGAGGCTCAGCCAAGCGCTATCGTCGATGAAATGCGGAAATCGTTG
rJMFF041F09+ GTTTTCAAGCTGAGAGAGGCTCAGCCAAGCGCTATCGTCGATGAAATGCGGAAATCGTTG
                      ____________________________________________________________
consensus GTTTTCAAGCTGAGAGAGGCTCAGCCAAGCGCTATCGTCGATGAAATGCGGAAATCGTTG
 
. : . : . : . : . : . :
rJMSF038G22+ ATCGACAGCTATGTTTAAGTTCTGTGCTTCACATCCACATAATGTAAGTTTTGTGCTGAA
rJMSF018I10+ ATCGACAGCTATGTTTAAGTTCTGTGCTTCACATCCACATAATGTAAGTTTTGTGCTGAA
rJMSF001G23+ ATCGACAGCTATGTTTAAGTTCTGTGCTTCACATCCACATAATGTAAGTTTTGTGCTGAA
rJMFF041F09+ ATCGACAGCTATGTTTAAGTTCTGTGCTTCACATCCACATAATGTAAGTTTTGTGCTGAA
                      ____________________________________________________________
consensus ATCGACAGCTATGTTTAAGTTCTGTGCTTCACATCCACATAATGTAAGTTTTGTGCTGAA
 
. : . : . : . : . : . :
rJMSF038G22+ AATTCACATAATGTGTGTTGAAAATTTTAAAGCTCATAACTAAATTGCTTTGCTTTTTAT
rJMSF018I10+ AATTCACATAATGTGTGTTGAAAATTTTAAAGCTCATAACTAAATTGCTTTGCTTTTTAT
rJMSF001G23+ AATTCACATAATGTGTGTTGAAAATTTTAAAGCTCATAACTAAATTGCTTTGCTTTTTAT
rJMFF041F09+ AATTCACATAATGTGTGTTGAAAATTTTAAAGCTCATAACTAAATTGCTTTGCTTTTTAT
                      ____________________________________________________________
consensus AATTCACATAATGTGTGTTGAAAATTTTAAAGCTCATAACTAAATTGCTTTGCTTTTTAT
 
. : . : . : . : . : . :
rJMSF038G22+ GTGCACAAGTACTCCTCCAAGAATGATT
rJMSF018I10+ GTGCACAAGTACTCCTCCAAGAATGATT
rJMSF001G23+ GTGCACAAGTACTCCTCCAAGAATGATT
rJMFF041F09+ GTGCACAAGTACTCCTCCAAGAATGATTTGCATATTTATAATATCAAATATAAACAAGTT
                      ____________________________________________________________
consensus GTGCACAAGTACTCCTCCAAGAATGATTTGCATATTTATAATATCAAATATAAACAAGTT