Previous Contig 010123:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041F05Sequence659004557 (2)pir|C96527|C965272e-60protein F27J15.26 [imported] - Arabidopsis thaliana>gb:AE005173_892837 Arabidops593010123 (2)gb:AK118233_18162212e-14Arabidopsis thaliana At1g48950 mRNA for unknown protein, complete cds, clone: RA
JMSF003N05Sequence371004557 (2)pir|C96527|C965271e-07protein F27J15.26 [imported] - Arabidopsis thaliana>gb:AE005173_892837 Arabidops744010123 (2)pir|C96527|C965276e-10protein F27J15.26 [imported] - Arabidopsis thaliana>gb:AE005173_892837 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003N05+ AAACT
                      ____________________________________________________________
consensus AAACT
 
. : . : . : . : . : . :
rJMSF003N05+ GGAGATGATCTTGGATCAAGTAGAGANGGNGGAGGCACATCTCATCAGGGAAAAACTANT
                      ____________________________________________________________
consensus GGAGATGATCTTGGATCAAGTAGAGANGGNGGAGGCACATCTCATCAGGGAAAAACTANT
 
. : . : . : . : . : . :
rJMSF003N05+ GAGCATAATGGATTAGAGGTTGGAACTTGCAATTCCANACAAGCAATCANGCAACGTGAC
                      ____________________________________________________________
consensus GAGCATAATGGATTAGAGGTTGGAACTTGCAATTCCANACAAGCAATCANGCAACGTGAC
 
. : . : . : . : . : . :
rJMSF003N05+ AGCAAGGATGATGGAGTACAATCGACAATTCAGANCCANGATGTTGTGCCAACTATAGCA
                      ____________________________________________________________
consensus AGCAAGGATGATGGAGTACAATCGACAATTCAGANCCANGATGTTGTGCCAACTATAGCA
 
. : . : . : . : . : . :
rJMSF003N05+ AAGGCTTTACAGGAAGTACCACTAGACAGAGGTACAGAGTTCGATCCGATAAGGCTACAC
rJMFF041F05+ TACAGGAAGTACCACTAGACAGAGGTACAGAGTTCGATCCGATAAGGCTACAC
                      ____________________________________________________________
consensus AAGGCTTTACAGGAAGTACCACTAGACAGAGGTACAGAGTTCGATCCGATAAGGCTACAC
 
. : . : . : . : . : . :
rJMSF003N05+ ANACATTTCTGTCCCTGGATTGCATCTAGTAGTGGCTCTGCACCNGGANGGCAACAAACT
rJMFF041F05+ AAACATTTCTGTCCCTGGATTGCATCTAGTAGTGGCTCTGCACCTGGATGGCAACAAACT
                      ____________________________________________________________
consensus AAACATTTCTGTCCCTGGATTGCATCTAGTAGTGGCTCTGCACCTGGATGGCAACAAACT
 
. : . : . : . : . : . :
rJMSF003N05+ TTATCTGCTTTGGAATCTAATAAGGAGTTTTCTCATCCTTTGACTGGAGATGCCCCTTCG
rJMFF041F05+ TTATCTGCTTTGGAATCTAATAAGGAGTTTTCTCATCCTTTGACTGGAGATGCCCCTTCG
                      ____________________________________________________________
consensus TTATCTGCTTTGGAATCTAATAAGGAGTTTTCTCATCCTTTGACTGGAGATGCCCCTTCG
 
. : . : . : . : . : . :
rJMSF003N05+ TCATCCCTGATTAAGGTTGATGATCCTGTTGCTTCGGTGAAAAGGCTTTTTATACCTACG
rJMFF041F05+ TCATCCCTGATTAAGGTTGATGATCCTGTTGCTTCGGTGAAAAGGCTTTTTATACCTACG
                      ____________________________________________________________
consensus TCATCCCTGATTAAGGTTGATGATCCTGTTGCTTCGGTGAAAAGGCTTTTTATACCTACG
 
. : . : . : . : . : . :
rJMSF003N05+ CCNGCAAAAAGAAAGAAGCTTATCCNGTCTAGTTAAACACAATATATTGCCACCAGATTG
rJMFF041F05+ CCTGCAAAAAGAAAGAAGCTTATCCAGTCTAGTTAAACACAATATATTGCCACCAGATTG
                      ____________________________________________________________
consensus CCTGCAAAAAGAAAGAAGCTTATCCAGTCTAGTTAAACACAATATATTGCCACCAGATTG
 
. : . : . : . : . : . :
rJMSF003N05+ CAAACCAGTGCAGTATGTTACGCTCTCAATTCACAAGAGGAAATGAAAGCAATGCATTTC
rJMFF041F05+ CAAACCAGTGCAGTATGTTACGCTCTCAATTCACAAGAGGAAATGAAAGCAATGCATTTC
                      ____________________________________________________________
consensus CAAACCAGTGCAGTATGTTACGCTCTCAATTCACAAGAGGAAATGAAAGCAATGCATTTC
 
. : . : . : . : . : . :
rJMSF003N05+ ATAATGGAGATCAATTTTATTNTGAGCCCCNTGGTCCTAGAGATGAGGTGGGGATGAGTT
rJMFF041F05+ ATAATGGAGATCAATTTTATTCTGAGCCCCTTGGTCCTAGAGATGAGGTGGGGATGAGTT
                      ____________________________________________________________
consensus ATAATGGAGATCAATTTTATTCTGAGCCCCTTGGTCCTAGAGATGAGGTGGGGATGAGTT
 
. : . : . : . : . : . :
rJMSF003N05+ GTCTGNCCAGTTCCTGTATTGCTTGAGATGTCTATTAACANTTTGAAATCGAAATAGAT
rJMFF041F05+ GTCTGACCAGTTCCTGTATTGCTTGAGATGTCTATTAACATTTTGAAATCGAAATAGATX
                      ____________________________________________________________
consensus GTCTGACCAGTTCCTGTATTGCTTGAGATGTCTATTAACATTTTGAAATCGAAATAGATN
 
. : . : . : . : . : . :
rJMFF041F05+ XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXAATATCCTTTTTTATGACTGCATTATTTT
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATATCCTTTTTTATGACTGCATTATTTT
 
. : . : . : . : . : . :
rJMFF041F05+ ACATTGTAAAAGATCCTATGATAAATATTATTCAAAAGTATGAATCAGTACAAGTTTGCC
                      ____________________________________________________________
consensus ACATTGTAAAAGATCCTATGATAAATATTATTCAAAAGTATGAATCAGTACAAGTTTGCC