Previous Contig 010118:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033D05Sequence555001487 (2)758010118 (2)pir|T45868|T458688e-23hypothetical protein F3A4.230 - Arabidopsis thaliana>gb:ATF3A4_1550569 Arabidops
JMFF041E04Sequence644001487 (2)620010118 (2)pir|T04647|T046471e-20hypothetical protein F10N7.210 - Arabidopsis thaliana>gb:ATCHRIV76_1547119 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF033D05+ CAAACAGTTAACAAAGAGTGGCCAACACTAGTGCATATTATCAGTGCCACG
                      ____________________________________________________________
consensus CAAACAGTTAACAAAGAGTGGCCAACACTAGTGCATATTATCAGTGCCACG
 
. : . : . : . : . : . :
rJMFF033D05+ GAGCTTCAAGACGTGGGAGTTATGTTTCATAACACTAGCGTAATCTACACTATGCCAAGG
                      ____________________________________________________________
consensus GAGCTTCAAGACGTGGGAGTTATGTTTCATAACACTAGCGTAATCTACACTATGCCAAGG
 
. : . : . : . : . : . :
rJMFF033D05+ CAATACCACACAGTTTCATCCTTAAAAGAGTGCAAGGATACAACTAGCCTATTCGACATA
rJMFF041E04+ CAACTAGCCTATTCGACATA
                      ____________________________________________________________
consensus CAATACCACACAGTTTCATCCTTAAAAGAGTGCAAGGATACAACTAGCCTATTCGACATA
 
. : . : . : . : . : . :
rJMFF033D05+ ACCTTTTCGGGCGGGGTGATGAAGATTCCTTCTTTCAAAGTCGACGACTTCACTGAAATA
rJMFF041E04+ ACCTTTTCGGGCGGGGTGATGAAGATTCCTTCTTTCAAAGTCGACGACTTCACTGAAATA
                      ____________________________________________________________
consensus ACCTTTTCGGGCGGGGTGATGAAGATTCCTTCTTTCAAAGTCGACGACTTCACTGAAATA
 
. : . : . : . : . : . :
rJMFF033D05+ TTCTTCCGAAACATGATTGCCCTGGAGCAATGCCGCACTCTAAAACCCAAATACTACACA
rJMFF041E04+ TTCTTCCGAAACATGATTGCCCTGGAGCAATGCCGCACTCTAAAACCCAAATACTACACA
                      ____________________________________________________________
consensus TTCTTCCGAAACATGATTGCCCTGGAGCAATGCCGCACTCTAAAACCCAAATACTACACA
 
. : . : . : . : . : . :
rJMFF033D05+ GATTACGCCAGGTTGATGGACCACCTGGTGGACACCAATAAAGACGTGAGTTTGCTCCGC
rJMFF041E04+ GATTACGCCAGGTTGATGGACCACCTGGTGGACACCAATAAAGACGTGAGTTTGCTCCGC
                      ____________________________________________________________
consensus GATTACGCCAGGTTGATGGACCACCTGGTGGACACCAATAAAGACGTGAGTTTGCTCCGC
 
. : . : . : . : . : . :
rJMFF033D05+ AAGAATGGAACCATTCACAACCTTTTAGGCGAAGATAAGAATGTGGCCGATGTGTTCAAC
rJMFF041E04+ AAGAATGGAACCATTCACAACCTTTTAGGCGAAGATAAGAATGTGGCCGATGTGTTCAAC
                      ____________________________________________________________
consensus AAGAATGGAACCATTCACAACCTTTTAGGCGAAGATAAGAATGTGGCCGATGTGTTCAAC
 
. : . : . : . : . : . :
rJMFF033D05+ AGTGTGTGTGTTAAGGTAGATATTACCACCAACTTCTATTTTGCACCGCTCTACACAGCT
rJMFF041E04+ AGTGTGTGTGTTAAGGTAGATATTACCACCAACTTCTATTTTGCACCGCTCTACACAGCT
                      ____________________________________________________________
consensus AGTGTGTGTGTTAAGGTAGATATTACCACCAACTTCTATTTTGCACCGCTCTACACAGCT
 
. : . : . : . : . : . :
rJMFF033D05+ CTGAATCGCCATTGTAGCAACAGACTCCTTGTGTGGAAGGCAAGACTAAAAAATGATTAT
rJMFF041E04+ CTGAATCGCCATTGTAGCAACAGACTCCTTGTGTGGAAGGCAAGACTAAAAAATGATTAT
                      ____________________________________________________________
consensus CTGAATCGCCATTGTAGCAACAGACTCCTTGTGTGGAAGGCAAGACTAAAAAATGATTAT
 
. : . : . : . : . : . :
rJMFF033D05+ TTCTCCGATCCGTGGAAAGGGATTTCCTCTATTGCTGGTGCTATCGTCTTGTTACTTGGT
rJMFF041E04+ TTCTCCGATCCGTGGAAAGGGATTTCCTCTATTGCTGGTGCTATCGTCTTGTTACTTGGT
                      ____________________________________________________________
consensus TTCTCCGATCCGTGGAAAGGGATTTCCTCTATTGCTGGTGCTATCGTCTTGTTACTTGGT
 
. : . : . : . : . : . :
rJMFF033D05+ GCCGCCCTCACACTCAAAAGTCTACTTTCTTAGACCCACCTCATTTCTCAATATGTGCAC
rJMFF041E04+ GCCGCCCTCACACTCAAAAGTCTACTTTCTTAGACCCACCTCATTTCTCAATATGTGCAC
                      ____________________________________________________________
consensus GCCGCCCTCACACTCAAAAGTCTACTTTCTTAGACCCACCTCATTTCTCAATATGTGCAC
 
. : . : . : . : . : . :
rJMFF033D05+ TACTTCAACTAGCTTCAATTCATCATTAATGTGTACTTTATACTAGCTGGTCACAATAAA
rJMFF041E04+ TACTTCAACTAGCTTCAATTCATCATTAATGTGTACTTTATACTAGCTGGTCACAATAAA
                      ____________________________________________________________
consensus TACTTCAACTAGCTTCAATTCATCATTAATGTGTACTTTATACTAGCTGGTCACAATAAA
 
. : . : . : . : . : . :
rJMFF033D05+ AGCGACGCATCTAGCTAGTTGCAAGGCTTAGTGTCTTA
rJMFF041E04+ AGCGACGCATCTAGCTAGTTGCAAGGCTTAGTGTCTTATGACCAGAGTTCATTAATGTGT
                      ____________________________________________________________
consensus AGCGACGCATCTAGCTAGTTGCAAGGCTTAGTGTCTTATGACCAGAGTTCATTAATGTGT