Previous Contig 010115:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041D09Sequence560014903543010115 (3)gb:AP004995_18469402e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF008F05Sequence476010115 (3)sp|Q8GXB7|TRMB_ARATH6e-45Probable tRNA (guanine-N(7)-)-methyltransferase (EC 2.1.1.33) (tRNA(m7G46)-methy754010115 (3)gb:AP004995_18469401e-72Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF008F05- TAAACACCACGACCAGGCAGAAAATAGAGAATTCCGGCAGCAACCA
                      ____________________________________________________________
consensus TAAACACCACGACCAGGCAGAAAATAGAGAATTCCGGCAGCAACCA
 
. : . : . : . : . : . :
JMSF008F05- AAATTCGTAAGGAAGAAATATGTTGGAAGGTGAAGGTAATCCTACTTTAAACAAGAAAAC
                      ____________________________________________________________
consensus AAATTCGTAAGGAAGAAATATGTTGGAAGGTGAAGGTAATCCTACTTTAAACAAGAAAAC
 
. : . : . : . : . : . :
JMSF008F05- AGGATTGCCTCGGAAACGATTTTACCGTGCAAGGGCTCATAGCAATCCGTTAAGTGATTC
                      ____________________________________________________________
consensus AGGATTGCCTCGGAAACGATTTTACCGTGCAAGGGCTCATAGCAATCCGTTAAGTGATTC
 
. : . : . : . : . : . :
JMSF008F05- ACATTTCCCAGTACCCATTTCCCCTGCTCAGGTGGACTATGTTTCTCATTACCCAAAATT
                      ____________________________________________________________
consensus ACATTTCCCAGTACCCATTTCCCCTGCTCAGGTGGACTATGTTTCTCATTACCCAAAATT
 
. : . : . : . : . : . :
JMSF008F05- ATCAGATGGCTTAAAAAAGATTGAGTTTGCAGATATAGGGTGTGGATTTGGTGGCCTTTT
rJMSF008F05+ TTT
                      ____________________________________________________________
consensus ATCAGATGGCTTAAAAAAGATTGAGTTTGCAGATATAGGGTGTGGATTTGGTGGCCTTTT
 
. : . : . : . : . : . :
JMSF008F05- GATTGCTCTTTCATCACTCTTTCCTGATACGGTAATGGTTGGAATGGAATTGAGGGATAA
rJMSF008F05+ GATTGCTCTTTCATCACTCTTTCCTGATACGGTAATGGTTGGAATGGAATTGAGGGATAA
                      ____________________________________________________________
consensus GATTGCTCTTTCATCACTCTTTCCTGATACGGTAATGGTTGGAATGGAATTGAGGGATAA
 
. : . : . : . : . : . :
JMSF008F05- GGTGACTGAGTATGTGAAAGAACGGATTGTGGCATTGAGGGCAAATAATCCTGGCCAATG
rJMSF008F05+ GGTGACTGAGTATGTGAAAGAACGGATTGTGGCATTGAGGGCAAATAATCCTGGCCAATG
                      ____________________________________________________________
consensus GGTGACTGAGTATGTGAAAGAACGGATTGTGGCATTGAGGGCAAATAATCCTGGCCAATG
 
. : . : . : . : . : . :
JMSF008F05- AGAATATATCGGTTGTTCGAACTAATTCCATGAAGTACATTCCAAAATTACTTTGAAAAA
rJMSF008F05+ AGAATATATCGGTTGTTCGAACTAATTCCATGAAGTACATTCC-AAATTACTTTGAAAAA
                      ____________________________________________________________
consensus AGAATATATCGGTTGTTCGAACTAATTCCATGAAGTACATTCCAAAATTACTTTGAAAAA
 
. : . : . : . : . : . :
JMSF008F05- GGGCAGCTGA
rJMSF008F05+ GGGCAGCTGAAAAAGATGTTCTTTTTGTTTCCGGATCCCCACTTTAAAGAGAAGAATCAC
rJMFF041D09+ C
                      ____________________________________________________________
consensus GGGCAGCTGAAAAAGATGTTCTTTTTGTTTCCGGATCCCCACTTTAAAGAGAAGAATCAC
 
. : . : . : . : . : . :
rJMSF008F05+ AGGCGACGCGTGATTAGTCCTCACCTGCTAGATGAGTATGCTTATGCTCTTGCTGTTGGT
rJMFF041D09+ AGGCGACGCGTGATTAGTCCTCACCTGATAGATGAGTATGCGTAGGCTCATGCTGTTGGT
                      ____________________________________________________________
consensus AGGCGACGCGTGATTAGTCCTCACCTGCTAGATGAGTATGCTTATGCTCTTGCTGTTGGT
 
. : . : . : . : . : . :
rJMSF008F05+ GGTATTATATACACGATCACAGACGTGGAGGAGCTTGGGGAGTGGATGA-AGTC-GTGTT
rJMFF041D09+ GGTATTAGATACACGATGGCAGACGTGCAGCAGCTTGGGGAGTGGATGACAGTCTGTGTT
                      ____________________________________________________________
consensus GGTATTATATACACGATGGCAGACGTGGAGGAGCTTGGGGAGTGGATGACAGTCTGTGTT
 
. : . : . : . : . : . :
rJMSF008F05+ TGGAAGATCACCCATTGTTTGAAGCTCTCTCAAATGAAGAGCTCGAAGCTGATCCGGCTG
rJMFF041D09+ TGGAGGGTCACCCATTGTTGGCAGCTGTCTCGAATCAAGAGCTGCAGGTTGATCGGGCTG
                      ____________________________________________________________
consensus TGGAGGGTCACCCATTGTTTGCAGCTGTCTCGAATGAAGAGCTGGAGGTTGATCGGGCTG
 
. : . : . : . : . : . :
rJMSF008F05+ TCAAACTCTTGACTACTGCAACCGAGGAAGGACAAAAGGTTGCCCGCAATGACGGACAGA
rJMFF041D09+ TCCAACTGTTGAGTCCTGCACCGGAGGAAGGTCAAAAGGTTGACCGCAATGACGGCCACC
                      ____________________________________________________________
consensus TCCAACTGTTGAGTCCTGCACCGGAGGAAGGTCAAAAGGTTGCCCGCAATGACGGCCAGC
 
. : . : . : . : . : . :
rJMSF008F05+ CGTTCCAAGCTGTTTATAGACGCATTGCTATGCGATGATTCATCATTGCCAATCTGTTTG
rJMFF041D09+ CGTTCCAAGCTGTTTATAAAAGCA-TGTTATGCGATGATTCATCATTGTCAATCTGTCTG
                      ____________________________________________________________
consensus CGTTCCAAGCTGTTTATAGACGCATTGTTATGCGATGATTCATCATTGTCAATCTGTTTG
 
. : . : . : . : . : . :
rJMSF008F05+ CTGATTGCTCATGCGTTGCAGTTGCAGTTGCAGTTTGGACACTCATC
rJMFF041D09+ CTGATTGCTCAGGCGTTGCAGTTGCAGCTGCAGTATGGGCACTCATCATAAGTCACGATA
                      ____________________________________________________________
consensus CTGATTGCTCATGCGTTGCAGTTGCAGTTGCAGTTTGGGCACTCATCATAAGTCACGATA
 
. : . : . : . : . : . :
rJMFF041D09+ GGATGATAAGCCCTATACACTGTGTCTTTTGCATTCTGTTTGGTATTATAGTGGCATAGT
                      ____________________________________________________________
consensus GGATGATAAGCCCTATACACTGTGTCTTTTGCATTCTGTTTGGTATTATAGTGGCATAGT
 
. : . : . : . : . : . :
rJMFF041D09+ TCAGCTAATAGATTTAATCTTTAGCCCCCGGAATAGCAATTATGGAGGCAGCTAAATATG
                      ____________________________________________________________
consensus TCAGCTAATAGATTTAATCTTTAGCCCCCGGAATAGCAATTATGGAGGCAGCTAAATATG
 
. : . : . : . : . : . :
rJMFF041D09+ GCATGGCTTCAGAGACGCATTATATTGTGTTGCAATACCTATGTGATTGATATTTTGAAT
                      ____________________________________________________________
consensus GCATGGCTTCAGAGACGCATTATATTGTGTTGCAATACCTATGTGATTGATATTTTGAAT