Previous Contig 010104:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002N02Sequence781010104 (18)gb:AP005603_18547062e-81Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B104
JMFF033L18Sequence591010104 (18)pir|T00692|T006921e-6360S ribosomal protein L7 [imported] - Arabidopsis thaliana>gb:AC004005_1531323 A769010104 (18)gb:AP005603_18547069e-89Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B104
JMFF036P03Sequence530010104 (18)sp|Q9LHP1|RL73_ARATH2e-5560S ribosomal protein L7-3.>gb:AY039900_1560414 Arabidopsis thaliana AT3g13580/K736010104 (18)gb:AP005603_18547062e-94Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B104
JMFF041B03Sequence652005061 (2)gb:AB028617_15180190.007Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MOA2.610010104 (18)gb:AY846828_16307292e-62Triticum aestivum ribosomal protein L7 mRNA, complete cds.
JMFF042F06Sequence635010104 (18)pir|T00692|T006923e-7160S ribosomal protein L7 [imported] - Arabidopsis thaliana>gb:AC004005_1531323 A618010104 (18)gb:AY846828_16307292e-63Triticum aestivum ribosomal protein L7 mRNA, complete cds.
JMFF050L05Sequence619010104 (18)pir|T00692|T006923e-6360S ribosomal protein L7 [imported] - Arabidopsis thaliana>gb:AC004005_1531323 A590010104 (18)gb:AP005603_18547065e-69Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B104
JMSF001K16Sequence350010104 (18)sp|Q9LHP1|RL73_ARATH5e-2260S ribosomal protein L7-3.>gb:AY039900_1560414 Arabidopsis thaliana AT3g13580/K747010104 (18)gb:AP005603_18547068e-92Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B104
JMSF003E11Sequence355010104 (18)sp|Q9LHP1|RL73_ARATH7e-2360S ribosomal protein L7-3.>gb:AY039900_1560414 Arabidopsis thaliana AT3g13580/K735010104 (18)gb:AP005603_18547062e-94Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B104
JMSF033J10Sequence675010104 (18)pir|T00692|T006922e-8160S ribosomal protein L7 [imported] - Arabidopsis thaliana>gb:AC004005_1531323 A749010104 (18)gb:AP005603_18547062e-92Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B104
JMSF050E05Sequence681010104 (18)pir|T00692|T006921e-8160S ribosomal protein L7 [imported] - Arabidopsis thaliana>gb:AC004005_1531323 A753010104 (18)gb:AP005603_18547062e-92Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B104

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF001K16- GGGCTG
JMFF036P03- TG
JMFF033L18- TG
JMFF042F06- TG
JMSF033J10- G
JMSF050E05- G
                      ____________________________________________________________
consensus GGGCTG
 
. : . : . : . : . : . :
JMSF001K16- CCTGCTGTACCTCCACGTAGAGAAAACACTCCGGCGGCCTTCATCTCCGATATCCAGATG
JMFF036P03- CCTGCTGTACCTCCACGTATAGAAAACACTCCGGCGGCCTTCATCTCCGATATCCAGATG
JMSF003E11- GCTGTACCTCCACGTAGAGAAAACACTCCGGCGGCCTTCATCTCCGATATCCAGATG
JMFF033L18- CCTGCTGTACCTCCACGTAGAGAAAACACTCCGGCGGCCTTCATCTCCGATATCCAGATG
JMFF042F06- CCTGCTGTACCTCCACGTAGAGAAAACACTCCGGCGGCCTTCATCTCCGATATCCAGATG
JMSF033J10- CCTGCTGTACCTCCACGTAGAGAAAACACTCCGGCGGCCTTCATCTCCGATATCCAGATG
JMSF050E05- CCTGCTGTACCTCCACGTAGAGAAAACACTCCGGCGGCCTTCATCTCCGATATCCAGATG
                      ____________________________________________________________
consensus CCTGCTGTACCTCCACGTAGAGAAAACACTCCGGCGGCCTTCATCTCCGATATCCAGATG
 
. : . : . : . : . : . :
JMSF001K16- GCTGAAGCAAAAACTGTTGTCCCTGAGTCGGTCTTGAAGAAGCAGAAGAGGCAAGGGGAG
JMFF036P03- GCTGAAGCAAAAACTGTTGTCCCTGAGTCGGTCTTGAAGAAGCAGAAGAGGCAAGGGGAG
JMSF003E11- GCTGAAGCAAAAACTGTTGTCCCTGAGTCGGTCTTGAAGAAGCAGAAGAGGCAAGGGGAG
JMFF033L18- GCTGAAGCAAAAACTGTTGTCCCTGAGTCGGTCTTGAAGAAGCAGAAGAGGCAAGGGGAG
JMFF050L05- CTGTTGTCCCTGAGTCGGTCTTGAAGAAGCAGAAGAGGCAAGGGGAG
JMFF042F06- GCTGAAGCAAAAACTGTTGTCCCTGAGTCGGTCTTGAAGAAGCAGAAGAGGCAAGGGGAG
JMSF033J10- GCTGAAGCAAAAACTGTTGTCCCTGAGTCGGTCTTGAAGAAGCAGAAGAGGCAAGGGGAG
JMSF050E05- GCTGAAGCAAAAACTGTTGTCCCTGAGTCGGTCTTGAAGAAGCAGAAGAGGCAAGGGGAG
                      ____________________________________________________________
consensus GCTGAAGCAAAAACTGTTGTCCCTGAGTCGGTCTTGAAGAAGCAGAAGAGGCAAGGGGAG
 
. : . : . : . : . : . :
JMSF001K16- TGGGCTCTGGCCAAGAAGCAAGAAATTGAAGCCATTAAGAAGAAGAATGCTGAGAACCGA
JMFF036P03- TGGGCTCTGGCCAAGAAGCAAGAAATTGAAGCCATTAAGAAGAAGAATGCTGAGAACCGA
JMSF003E11- TGGGCTCTGGCCAAGAAGCAAGAAATTGAAGCCATTAAGAAGAAGAATGCTGAGAACCGA
JMFF033L18- TGGGCTCTGGCCAAGAAGCAAGAAATTGAAGCCATTAAGAAGAAGAATGCTGAGAACCGA
JMFF050L05- TGGGCTCTGGCCAAGAAGCAAGAAATTGAAGCCATTAAGAAGAAGAATGCTGAGAACCGA
JMFF042F06- TGGGCTCTGGCCAAGAAGCAAGAAATTGAAGCCATTAAGAAGAAGAATGCTGAGAACCGA
JMSF033J10- TGGGCTCTGGCCAAGAAGCAAGAAATTGAAGCCATTAAGAAGAAGAATGCTGAGAACCGA
JMSF050E05- TGGGCTCTGGCCAAGAAGCAAGAAATTGAAGCCATTAAGAAGAAGAATGCTGAGAACCGA
                      ____________________________________________________________
consensus TGGGCTCTGGCCAAGAAGCAAGAAATTGAAGCCATTAAGAAGAAGAATGCTGAGAACCGA
 
. : . : . : . : . : . :
JMSF001K16- AAGATTATTTTCAACAGGGCTAAGCAGTATGCCAAGGAATACGAGGAGCAGCAAAAGGAG
JMFF036P03- AAGATTATTTTCAACAGGGCTAAGCAGTATGCCAAGGAATACGAGGAGCAGCAAAAGGAG
JMSF003E11- AAGATTATTTTCAACAGGGCTAAGCAGTATGCCAAGGAATACGAGGAGCAGCAAAAGGAG
JMFF033L18- AAGATTATTTTCAACAGGGCTAAGCAGTATGCCAAGGAATACGAGGAGCAGCAAAAGGAG
JMFF050L05- AAGATTATTTTCAACAGGGCTAAGCAGTATGCCAAGGAATACGAGGAGCAGCAAAAGGAG
JMFF042F06- AAGATTATTTTCAACAGGGCTAAGCAGTATGCCAAGGAATACGAGGAGCAGCAAAAGGAG
JMSF033J10- AAGATTATTTTCAACAGGGCTAAGCAGTATGCCAAGGAATACGAGGAGCAGCAAAAGGAG
JMSF050E05- AAGATTATTTTCAACAGGGCTAAGCAGTATGCCAAGGAATACGAGGAGCAGCAAAAGGAG
rJMSF050E05+ GGCTAAGCAGTATGCCAAGGAATACGAGGAGCAGCAAAAGGAG
rJMSF033J10+ AGCAGTATGCCAAGGAATACGAGGAGCAGCAAAAGGAG
rJMFF036P03+ GAGGAGCAGCAAAAGGAG
rJMSF003E11+ ACGAGGAGCAGCAAAAGGAG
rJMSF001K16+ GGGCTAAGCAGTATGCCAAGGAATACGAGGAGCAGCAAAAGGAG
rJMFF002N02+ GGCTAAGCAGTATGCCAAGGAATACGAGGAGCAGCAAAAGGAG
rJMFF033L18+ TTCANCAGGGCTAAGCAGTATGCCAAGGAATACGAGGAGCAGCAAAAGGAG
                      ____________________________________________________________
consensus AAGATTATTTTCAACAGGGCTAAGCAGTATGCCAAGGAATACGAGGAGCAGCAAAAGGAG
 
. : . : . : . : . : . :
JMSF001K16- CTGGTTCAGTTGAAGCGTGAGGCGAGGCTGAAAGGAGGCTTCTATGTTAACCCTGAAGCA
JMFF036P03- CTGGTTCAGTTGAAGCGTGAGGCGAGGCTGAAAGGAGGCTTCTATGTTAACCCTGAAGCA
JMSF003E11- CTGGTTCAGTTGAAGCGTGAGGCGAGGCTGAAAGGAGGCTTCTATGTTAACCCTGAAGCA
JMFF033L18- CTGGTTCAGTTGAAGCGTGAGGCGAGGCTGAAAGGAGGCTTCTATGTTAACCCTGAAGCA
JMFF050L05- CTGGTTCAGTTGAAGCGTGAGGCGAGGCTGAAAGGAGGCTTCTATGTTAACCCTGAAGCA
JMFF042F06- CTGGTTCAGTTGAAGCGTGAGGCGAGGCTGAAAGGAGGCTTCTATGTTAACCCTGAAGCA
JMSF033J10- CTGGTTCAGTTGAAGCGTGAGGCGAGGCTGAAAGGAGGCTTCTATGTTAACCCTGAAGCA
JMSF050E05- CTGGTTCAGTTGAAGCGTGAGGCGAGGCTGAAAGGAGGCTTCTATGTTAACCCTGAAGCA
rJMSF050E05+ CTGGTTCAGTTGAAGCGTGAGGCGAGGCTGAAAGGAGGCTTCTATGTTAACCCTGAAGCA
rJMSF033J10+ CTGGTTCAGTTGAAGCGTGAGGCGAGGCTGAAAGGAGGCTTCTATGTTAACCCTGAAGCA
rJMFF036P03+ CTGGTTCAGTTGAAGCGTGAGGCGAGGCTGAAAGGAGGCTTCTATGTTAACCCTGAAGCA
rJMSF003E11+ CTGGTTCAGTTGAAGCGTGAGGCGAGGCTGAAAGGAGGCTTCTATGTTAACCCTGAAGCA
rJMSF001K16+ CTGGTTCAGNTGAAGCGTGAGGCGAGGCTGAAAGGAGGCTTCTATGTTAACCCTGAAGCA
rJMFF002N02+ CTGGTTCAGTTGAAGCGTGAGGCGAGGCTGAAAGGAGGCTTCTATGTTAACCCTGAAGCA
rJMFF033L18+ CTGNTTCAGTTGAAGCGTGAGGCGAGGCTGAAAGGAGGCTTCTATGTTAACCNTGAAGCA
                      ____________________________________________________________
consensus CTGGTTCAGTTGAAGCGTGAGGCGAGGCTGAAAGGAGGCTTCTATGTTAACCCTGAAGCA
 
. : . : . : . : . : . :
JMSF001K16- AAATTGTTGTTCATTATTCGCATCCGTGGTATCAATGCTATGCA
JMFF036P03- AAATTGTTGTTCATTATTCGCATCCGTGGTATCAATGCTATGCACCCCCAGAC-AAAGAA
JMSF003E11- AAATTGTTGTTCATTATTCGCATCCGTGGTATCAATGCTATGCACCCCCAGAC
JMFF033L18- AAATTGTTGTTCATTATTCGCATCCGTGGTATCAATGCTATGCACCCCCAGAC-AAAGAA
JMFF050L05- AAATTGTTGTTCATTATTCGCATCCGTGGTATCAATGCTATGCACCCCCAGAC-AAAGAA
JMFF042F06- AAATTGTTGTTCATTATTCGCATCCGTGGTATCAATGCTATGCACCCCCAGAC-AAAGAA
JMSF033J10- AAATTGTTGTTCATTATTCGCATCCGTGGTATCAATGCTATGCACCCCCAGAC-AAAGAA
JMSF050E05- AAATTGTTGTTCATTATTCGCATCCGTGGTATCAATGCTATGCACCCCCAGAC-AAAGAA
rJMSF050E05+ AAATTGTTGTTCATTATTCGCATCCGTGGTATCAATGCTATGCACCCCCAGAC-AAAGAA
rJMSF033J10+ AAATTGTTGTTCATTATTCGCATCCGTGGTATCAATGCTATGCACCCCCAGAC-AAAGAA
rJMFF036P03+ AAATTGTTGTTCATTATTCGCATCCGTGGTATCAATGCTATGCACCCCCAGAC-AAAGAA
rJMSF003E11+ AAATTGTTGTTCATTATTCGCATCCGTGGTATCAATGCTATGCACCCCCAGAC-AAAGAA
rJMSF001K16+ AAATTGTTGTTCATTATTCGCATCCGTGGTATCAATGCTATGCACCCCCAGAC-AAAGAA
rJMFF050L05+ CCCCAGAC-AAAGAA
rJMFF002N02+ AAATTGTTGTTCATTATTCGCATCCGTGGTATCAATGCTATGCACCCCCAGACAAAAGAA
rJMFF033L18+ AAATTGTTGTTCATTATTCGCATCCGTGGTATCAATGCTATGCACCCCCAGAC-AAAGAA
                      ____________________________________________________________
consensus AAATTGTTGTTCATTATTCGCATCCGTGGTATCAATGCTATGCACCCCCAGAC-AAAGAA
 
. : . : . : . : . : . :
JMFF036P03- GATATTGCAGCTTC-TCCGTTTGAGACAGATTTTCAATGGTGTATTCCTAAAGGTCAACA
JMFF033L18- GATATTGCAGCTTC-TCCGTTTGAGACAGATTTTCAATGGTGTATTCCTAAAGGTCAACA
JMFF050L05- GATATTGCAGCTTC-TCCGTTTGAGACAGATTTTCAATGGTGTATTCCTAAAGGTCAACA
JMFF042F06- GATATTGCAGCTTC-TCCGTTTGAGACAGATTTTCAATGGTGTATTCCTAAAGGTCAACA
JMSF033J10- GATATTGCAGCTTC-TCCGTTTGAGACAGATTTTCAATGGTGTATTCCTAAAGGTCAACA
JMSF050E05- GATATTGCAGCTTC-TCCGTTTGAGACAGATTTTCAATGGTGTATTCCTAAAGGTCAACA
rJMSF050E05+ GATATTGCAGCTTC-TCCGTTTGAGACAGATTTTCAATGGTGTATTCCTAAAGGTCAACA
rJMSF033J10+ GATATTGCAGCTTC-TCCGTTTGAGACAGATTTTCAATGGTGTATTCCTAAAGGTCAACA
rJMFF036P03+ GATATTGCAGCTTC-TCCGTTTGAGACAGATTTTCAATGGTGTATTCCTAAAGGTCAACA
rJMSF003E11+ GATATTGCAGCTTC-TCCGTTTGAGACAGATTTTCAATGGTGTATTCCTAAAGGTCAACA
rJMSF001K16+ GATATTGCAGCTTC-TCCGTTTGAGACAGATTTTCAATGGTGTATTCCTAAAGGTCAACA
rJMFF050L05+ GATATTGCAGCTTCTTCCGTTTGAGACAGATTTTCAATGGTGTATTCCTAAAGGTCAACA
rJMFF002N02+ GATATTGCAGCTTC-TCCGTTTGAGACAGATTTTCAATGGTGTATTCCTAAAGGTCAACA
rJMFF033L18+ GATATTGCAGCTTC-TCCGTTTGAGACAGATTTTCAATGGTGTATTCCTAAAGGTCAACA
rJMFF042F06+ AGACAGATTTTCAATGGTGT-TTCNTAAAGGTCAACA
rJMFF041B03+ CTAAAGGTCAACA
                      ____________________________________________________________
consensus GATATTGCAGCTTC-TCCGTTTGAGACAGATTTTCAATGGTGTATTCCTAAAGGTCAACA
 
. : . : . : . : . : . :
JMFF036P03- AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACCTATGGGTATCCTAACT
JMFF033L18- AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACCTATGGGTATCCTAACT
JMFF050L05- AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACCTATGGGTATCCTAACT
JMFF042F06- AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACCTATGGGTATCCTAACT
JMSF033J10- AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACCTATGGGTATCCTAACT
JMSF050E05- AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACCTATGGGTATCCTAACT
rJMSF050E05+ AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACCTATGGGTATCCTAACT
rJMSF033J10+ AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACCTATGGGTATCCTAACT
rJMFF036P03+ AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACCTATGGGTATCCTAACT
rJMSF003E11+ AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACCTATGGGTATCCTAACT
rJMSF001K16+ AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACCTATGGGTATCCTAACT
rJMFF050L05+ AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACCTATGGGTATCCTAACT
rJMFF002N02+ AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACCTATGGGTATCCTAACT
rJMFF033L18+ AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACCTATGGGTATCCTAACT
rJMFF042F06+ AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACNTATGGGTATCCTAACT
rJMFF041B03+ AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACCTATGGGTATCCTAACT
                      ____________________________________________________________
consensus AAGCAACAATCAACATGTTGCACAGGGTTGAGCCATATGTGACCTATGGGTATCCTAACT
 
. : . : . : . : . : . :
JMFF036P03- TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTT
JMFF033L18- TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTTAACAAGCAAAGGA
JMFF050L05- TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTTAACAAGCAAAGGA
JMFF042F06- TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTTAACAAGCAAAGGA
JMSF033J10- TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTTAACAAGCAAAGGA
JMSF050E05- TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTTAACAAGCAAAGGA
rJMSF050E05+ TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTTAACAAGCAAAGGA
rJMSF033J10+ TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTTAACAAGCAAAGGA
rJMFF036P03+ TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTTAACAAGCAAAGGA
rJMSF003E11+ TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTTAACAAGCAAAGGA
rJMSF001K16+ TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTTAACAAGCAAAGGA
rJMFF050L05+ TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTTAACAAGCAAAGGA
rJMFF002N02+ TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTTAACAAGCAAAGGA
rJMFF033L18+ TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTTAACAAGCAAAGGA
rJMFF042F06+ TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTTAACAAGCAAAGGA
rJMFF041B03+ TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTTAACAAGCAAAGGA
                      ____________________________________________________________
consensus TGAAGAGTGTGAAGGAGTTGATATACAAAAGGGGCTATGGAAAGGTTAACAAGCAAAGGA
 
. : . : . : . : . : . :
JMFF033L18- TTCCCTTGACTGAGAACTCTATCATTGAACAGACTCTTGGCAAGCACA
JMFF050L05- TTCCCTTGACTGAGAACTCTATCATTGAACAGACTCTTTGGCAGCACAACATAATTT
JMFF042F06- TTCCCTTGACTGAGAACTCTATCATTGAACAGACTCTTGGCAAGCACAACATAATTTGTG
JMSF033J10- TTCCCTTGACTGAGAACTCTATCATTGAACAGACTCTTGGCAAGCACAACATAATTTGTG
JMSF050E05- TTCCCTTGACTGAGAACTCTATCATTGAACAGACTCTTGGCAAGCACAACATAATTTGTG
rJMSF050E05+ TTCCCTTGACTGAGAACTCTATCATTGAACAGACTCTTGGCAAGCACAACATAATTTGTG
rJMSF033J10+ TTCCCTTGACTGAGAACTCTATCATTGAACAGACTCTTGGCAAGCACAACATAATTTGTG
rJMFF036P03+ TTCCCTTGACTGAGAACTCTATCATTGAACAGACTCTTGGCAAGCACAACATAATTTGTG
rJMSF003E11+ TTCCCTTGACTGAGAACTCTATCATTGAACAGACTCTTGGCAAGCACAACATAATTTGTG
rJMSF001K16+ TTCCCTTGACTGAGAACTCTATCATTGAACAGACTCTTGGCAAGCACAACATAATTTGTG
rJMFF050L05+ TTCCCTTGACTGAGAACTCTATCATTGAACAGACTCTTGGCAAGCACAACATAATTTGTG
rJMFF002N02+ TTCCCTTGACTGAGAACTCTATCATTGAACAGACTCTTGGCAAGCACAACATAATTTGTG
rJMFF033L18+ TTCCCTTGACTGAGAACTCTATCATTGAACAGACTCTTGGCAAGCACAACATAATTTGTG
rJMFF042F06+ TTCCCTTGACTGAGAACTCTATCATTGAACAGACTCTTGGCAAGCACAACATAATTTGTG
rJMFF041B03+ TTCCCTTGACTGAGAACTCTATCATTGAACAGACTCTTGGCAAGCACAACATAATTTGTG
                      ____________________________________________________________
consensus TTCCCTTGACTGAGAACTCTATCATTGAACAGACTCTTGGCAAGCACAACATAATTTGTG
 
. : . : . : . : . : . :
JMFF042F06- TCGAAGATCTTGTTCACGAGATCATCACTGTT
JMSF033J10- TCGAAGATCTTGTTCACGAGATCATCACTGTTGGACCGCACTTCAAGGAAGCTAACAATT
JMSF050E05- TCGAAGATCTTGTTCACGAGATCATCACTGTTGGACCGCACTTCAAGGAAGCTAACAATT
rJMSF050E05+ TCGAAGATCTTGTTCACGAGATCATCACTGTTGGACCGCACTTCAAGGAAGCTAACAATT
rJMSF033J10+ TCGAAGATCTTGTTCACGAGATCATCACTGTTGGACCGCACTTCAAGGAAGCTAACAATT
rJMFF036P03+ TCGAAGATCTTGTTCACGAGATCATCACTGTTGGACCGCACTTCAAGGAAGCTAACAATT
rJMSF003E11+ TCGAAGATCTTGTTCACGAGATCATCACTGTTGGACCGCACTTCAAGGAAGCTAACAATT
rJMSF001K16+ TCGAAGATCTTGTTCACGAGATCATCACTGTTGGACCGCACTTCAAGGAAGCTAACAATT
rJMFF050L05+ TCTAAGATCTTGTTCACGAGATCATCACTGTTGGACCGCACTTCAAGGAAGCTAACAATT
rJMFF002N02+ TCGAAGATCTTGTTCACGAGATCATCACTGTTGGACCGCACTTCAAGGAAGCTAACAATT
rJMFF033L18+ TCGAAGATCTTGTTCACGAGATCATCACTGTTGGACCGCACTTCAAGGAAGCTAACAATT
rJMFF042F06+ TCGAAGATCTTGTTCACGAGATCATCACTGTTGGACCGCACTTCAAGGAAGCTAACAATT
rJMFF041B03+ TCGAAGATCTTGTTCACGAGATCATCACTGTTGGACCGCACTTCAAGGAAGCTAACAATT
                      ____________________________________________________________
consensus TCGAAGATCTTGTTCACGAGATCATCACTGTTGGACCGCACTTCAAGGAAGCTAACAATT
 
. : . : . : . : . : . :
JMSF033J10- TCCTTTGGCCATTCC
JMSF050E05- TCCTTTGGCCATTCCNACTCA
rJMSF050E05+ TCCTTTGGCCATTCCAACTCAAGGCTCCACTAGGTGGTCTTAAGAAGAAAAGAAACCACT
rJMSF033J10+ TCCTTTGGCCATTCCAACTCAAGGCTCCACTAGGTGGTCTTAAGAAGAAAAGAAACCACT
rJMFF036P03+ TCCTTTGGCCATTCCAACTCAAGGCTCCACTAGGTGGTCTTAAGAAGAAAAGAAACCACT
rJMSF003E11+ TCCTTTGGCCATTCCAACTCAAGGCTCCACTAGGTGGTCTTAAGAAGAAAAGAAACCACT
rJMSF001K16+ TCCTTTGGCCATTCCAACTCAAGGCTCCACTAGGTGGTCTTAAGAAGAAAAGAAACCACT
rJMFF050L05+ TCCTTTGGCCATTCCAACTCAAGGCTCCACTAGGTGGTCTTAAGAAGAAAAGAAACCACT
rJMFF002N02+ TCCTTTGGCCATTCCAACTCAAGGCTCCACTAGGTGGTCTTAAGAAGAAAAGAAACCACT
rJMFF033L18+ TCCTTTGGCCATTCCAACTCAAGGCTCCACTAGGTGGTCTTAAGAAGAAAAGAAACCACT
rJMFF042F06+ TCCTTTGGCCATTCCAACTCAAGGCTCCACTAGGTGGTCTTAAGAAGAAAAGAAACCACT
rJMFF041B03+ TCCTTTGGCCATTCCAACTCAAGGCTCCACTAGGTGGTCTTAAGAAGAAAAGAAGCCACT
                      ____________________________________________________________
consensus TCCTTTGGCCATTCCAACTCAAGGCTCCACTAGGTGGTCTTAAGAAGAAAAGAAACCACT
 
. : . : . : . : . : . :
rJMSF050E05+ ATGTTGAAGGAGGAGATGCTGGAAACAGGGAAGATTATATCAATGAACTGATTAGAAGAA
rJMSF033J10+ ATGTTGAAGGAGGAGATGCTGGAAACAGGGAAGATTATATCAATGAACTGATTAGAAGAA
rJMFF036P03+ ATGTTGAAGGAGGAGATGCTGGAAACAGGGAAGATTATATCAATGAACTGATTAGAAGAA
rJMSF003E11+ ATGTTGAAGGAGGAGATGCTGGAAACAGGGAAGATTATATCAATGAACTGATTAGAAGAA
rJMSF001K16+ ATGTTGAAGGAGGAGATGCTGGAAACAGGGAAGATTATATCAATGAACTGATTAGAAGAA
rJMFF050L05+ ATGTTGAAGGAGGAGATGCTGGAAACAGGGAAGATTATATCAATGAACTGATTAGAAGAA
rJMFF002N02+ ATGTTGAAGGAGGAGATGCTGGAAACAGGGAAGATTATATCAATGAACTGATTAGAAGAA
rJMFF033L18+ ATGTTGAAGGAGGAGATGCTGGAAACAGGGAAGATTATATCAATGAACTGATTAGAAGAA
rJMFF042F06+ ATGTTGAAGGAGGAGATGCTGGAAACAGGGAAGATTATATCAATGAACTGATTAGAAGAA
rJMFF041B03+ ATGTTGAAGGAGGAGATGCTGGAAACAGGGAAGATTATATCAATGAACTGATTAGAAGAA
                      ____________________________________________________________
consensus ATGTTGAAGGAGGAGATGCTGGAAACAGGGAAGATTATATCAATGAACTGATTAGAAGAA
 
. : . : . : . : . : . :
rJMSF050E05+ TGAACTAGACATTGGTGGGTGCCTGACCTTCAGTCTGTCAAAGATTTTGAAAGTTCTTTT
rJMSF033J10+ TGAACTAGACATTGGTGGGTGCCTGACCTTCAGTCTGTCAAAGATTTTGAAAGTTCTTTT
rJMFF036P03+ TGAACTAGACATTGGTGGGTGCCTGACCTTCAGTCTGTCAAAGATTTTGAAAGTTCTTTT
rJMSF003E11+ TGAACTAGACATTGGTGGGTGCCTGACCTTCAGTCTGTCAAAGATTTTGAAAGTTCTTTT
rJMSF001K16+ TGAACTAGACATTGGTGGGTGCCTGACCTTCAGTCTGTCAAAGATTTTGAAAGTTCTTTT
rJMFF050L05+ TGAACTAGACATTGGTGGGTGCCTGACCTTCAGTCTGTCAAAGATTTTGAAAGTTCTTTT
rJMFF002N02+ TGAA
rJMFF033L18+ TGAACTAGACATTGGTGGGTGCCTGACCTTCAGTCTGTCAAAGATTTTGAAAGTTCTTTT
rJMFF042F06+ TGAACTAGACATTGGTGGGTGCCTGACCTTCAGTCTGTCAAAGATTTTGAAAGTTCTTTT
rJMFF041B03+ TGAACTAGACATTGGTGGGTGCCTGACCTTCAGTCTGTCAAAGATTTTGAAAGTTCTTTT
                      ____________________________________________________________
consensus TGAACTAGACATTGGTGGGTGCCTGACCTTCAGTCTGTCAAAGATTTTGAAAGTTCTTTT
 
. : . : . : . : . : . :
rJMSF050E05+ GTTGCCCATTGTGAGTTGGATGAGTTATTTGTTTTTAGTTTGGCTTGAA-CATTTTGGTT
rJMSF033J10+ GTTGCCCATTGTGAGTTGGATGAGTTATTTGTTTTTAGTTTGGCTTGAA-CATTTTGGTT
rJMFF036P03+ GTTGCCCATTGTGAGTTGGATGAGTTATTTGTTTTTAGTTTGGCTTGAA-CATTTTGGTT
rJMSF003E11+ GTTGCCCATTGTGAGTTGGATGAGTTATTTGTTTTTAGTTTGGCTTGAA-CATTTTGGTT
rJMSF001K16+ GTTGCCCATTGTGAGTTGGATGAGTTATTTGTTTTTAGTTTGGCTTGAACCATTTTGGTT
rJMFF050L05+ GTTGCCCATTGTGAGTTGGATGAGTTATTTGTTTTTAGTTTGGCTTGAA-CATTTTGGTT
rJMFF033L18+ GTTGCCCATTGTGAGTTGGATGAGTTATTTGTTTTTAGTTTGGCTTGAA-CATTTTGGTT
rJMFF042F06+ GTTGCCCATTGTGAGTTGGATGAGTTATTTGTTTTTAGTTTGGCTTGAA-CATTTTGGTT
rJMFF041B03+ GTTGCCCATTGTGAGTTGGATGAGTTATTTGTTTTTAGTTTGGCTTGAA-CATTTTGGTT
                      ____________________________________________________________
consensus GTTGCCCATTGTGAGTTGGATGAGTTATTTGTTTTTAGTTTGGCTTGAA-CATTTTGGTT
 
. : . : . : . : . : . :
rJMSF050E05+ TTTCTTTATT-AAAACAGGTGATTAG-CATGTTGTTGACTATGCCTTCTACATTT
rJMSF033J10+ TTTCTTTATT-AAAACAGGTGATTAGCCATGTTGTTGACTATGCCTTCTACATTT
rJMFF036P03+ TTTCTTTATT-AAAACAGGTGATTAG-CATGTTGTTGACTATGCCTTCTACATTTTACTC
rJMSF003E11+ TTTCTTTATT--AACCAGGTGATTAG-CATGTTGTTGACTATGCCTTCTACATTTTACTC
rJMSF001K16+ TTTCTTTATTAAAAACAGGTGATTAGCCATGTTGTTGACTATGCC
rJMFF050L05+ TTTCTTTATT-AAAACAGGTGATTAG-CATGTTGTTGAC
rJMFF033L18+ TTTCTTTATT-AAAACAGGTGATTAG-CATGTTGTTGACTATGCCTTCTACATTTTACTC
rJMFF042F06+ TTTCTTTATT-AAAACAGGTGATTAG-CATGTTGTTGACTATGCCTTCTACATTTTACTC
rJMFF041B03+ TTTCTTTATT-AAAACAGGTGATTAG-CATGTTGTTGACTATGCCTTCTACATTTTACTC
                      ____________________________________________________________
consensus TTTCTTTATT-AAAACAGGTGATTAG-CATGTTGTTGACTATGCCTTCTACATTTTACTC
 
. : . : . : . : . : . :
rJMFF036P03+ AGT
rJMSF003E11+ A
rJMFF033L18+ AGT
rJMFF042F06+ AGTATTCTGGATTTATAGCCTTAATGCAATTTTACTTTGTTTA
rJMFF041B03+ AGTATTCTGGATTTATAGCCTTAATGCAATTTTACTTTGTTTATCAAAAAAAAAAAAAAA
                      ____________________________________________________________
consensus AGTATTCTGGATTTATAGCCTTAATGCAATTTTACTTTGTTTATCAAAAAAAAAAAAAAA