Previous Contig 010102:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041B01Sequence662010102 (4)gb:NTRPL121A_16917574e-57N.tabacum mRNA for ribosomal protein L12-1a.620010102 (4)gb:NTRPL121A_16917579e-47N.tabacum mRNA for ribosomal protein L12-1a.
JMFF042J14Sequence654010102 (4)gb:NTRPL121A_16917574e-56N.tabacum mRNA for ribosomal protein L12-1a.503010102 (4)gb:NTRPL121A_16917572e-27N.tabacum mRNA for ribosomal protein L12-1a.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF042J14- ACATTGCTTCCCTGCGTCTAACTCTCTACACTCTCTTCTCC
JMFF041B01- ACATTGCTTCCCTGCGTCTAACTCTCTACACTCTCTTCTCC
                      ____________________________________________________________
consensus ACATTGCTTCCCTGCGTCTAACTCTCTACACTCTCTTCTCC
 
. : . : . : . : . : . :
JMFF042J14- TTTCCTCATCTCACTATCCAAAAATGGCTTCCACTCTATCCACTGTCACCCTCCGTTCTC
JMFF041B01- TTTCCTCATCTCACTATCCAAAAATGGCTTCCACTCTATCCACTGTCACCCTCCGTTCTC
                      ____________________________________________________________
consensus TTTCCTCATCTCACTATCCAAAAATGGCTTCCACTCTATCCACTGTCACCCTCCGTTCTC
 
. : . : . : . : . : . :
JMFF042J14- CTTCCCATCCCGCCCCTTCCGCATCCAATTCCTTGCTTCCGGCAACCGCCTTCCCCAAAC
JMFF041B01- CTTCCCATCCCGCCCCTTCCGCATCCAATTCCTTGCTTCCGGCAACCGCCTTCCCCAAAC
                      ____________________________________________________________
consensus CTTCCCATCCCGCCCCTTCCGCATCCAATTCCTTGCTTCCGGCAACCGCCTTCCCCAAAC
 
. : . : . : . : . : . :
JMFF042J14- AAGCCGTACAATTCCCGCTCCGCACCCCGAAACTCCCCCGCCGAGCCACATTCCTCCGCC
JMFF041B01- AAGCCGTACAATTCCCGCTCCGCACCCCGAAACTCCCCCGCCGAGCCACATTCCTCCGCC
rJMFF041B01+ CCGAGCCACATTCCTCNGCC
                      ____________________________________________________________
consensus AAGCCGTACAATTCCCGCTCCGCACCCCGAAACTCCCCCGCCGAGCCACATTCCTCCGCC
 
. : . : . : . : . : . :
JMFF042J14- CTCTCGCCGCCGTGGATGCGCCCGAGAAGGTGGTGCAGCTCGGGGACGAAATCTCCAGCC
JMFF041B01- CTCTCGCCGCCGTGGATGCGCCCGAGAAGGTGGTGCAGCTCGGGGACGAAATCTCCAGCC
rJMFF041B01+ CTCTCGCCGCCGTGGATGCGCCCGAGAAGGTGGTGCAGCTCGGGGACGAAATCTCCAGCC
                      ____________________________________________________________
consensus CTCTCGCCGCCGTGGATGCGCCCGAGAAGGTGGTGCAGCTCGGGGACGAAATCTCCAGCC
 
. : . : . : . : . : . :
JMFF042J14- TCACCCTCGCCGACGCCCAGAAACTCGTCGAGTACCTCCAGGACAAGCTCGGAGTCTCCG
JMFF041B01- TCACCCTCGCCGACGCCCAGGAACTCGTCGAGTACCTCCAGGACAAGCTCGGAGTCTCCG
rJMFF042J14+ TCCAGGACAAGCTCGGAGTCTCCG
rJMFF041B01+ TCACCCTCGCCGACGCCCAGGAACTCGTCGAGTACCTCCAGGACAAGCTCGGAGTCTCCG
                      ____________________________________________________________
consensus TCACCCTCGCCGACGCCCAGGAACTCGTCGAGTACCTCCAGGACAAGCTCGGAGTCTCCG
 
. : . : . : . : . : . :
JMFF042J14- CCGCGATGATGGCCCCCGCGGCCGCCGTCGTCGCCGCTCCCGGAGCCGGCGGCGAGGCCG
JMFF041B01- CCGCGATGATGGCCCCCGCGGCCGCCGTCGTCGCCGCTCCCGGAGCCGGCGGCGAGGCCG
rJMFF042J14+ CCGCGATGATGGCCCCCGCGGCCGCCGTCGTCGCCGCTCCCGGAGCCGGCGGCGAGGCCG
rJMFF041B01+ CCGCGATGATGGCCCCCGCGGCCGCCGTCGTCGCCGCTCCCGGAGCCGGCGGCGAGGCCG
                      ____________________________________________________________
consensus CCGCGATGATGGCCCCCGCGGCCGCCGTCGTCGCCGCTCCCGGAGCCGGCGGCGAGGCCG
 
. : . : . : . : . : . :
JMFF042J14- CCCCCGTAGTGGAAGAGAAGACGGAGTTCGACGTGGTGATCGAAGAGGTGCCGAGCAACG
JMFF041B01- CCCCCGTAGTGGAAGAGAAGACGGAGTTCGACGTGGTGATCGAAGAGGTGCCGAGCAACG
rJMFF042J14+ CCCCCGTAGTGGAAGAGAAGACGGAGTTCGACGTGGTGATCGAAGAGGTGCCGAGCAACG
rJMFF041B01+ CCCCCGTAGTGGAAGAGAAGACGGAGTTCGACGTGGTGATCGAAGAGGTGCCGAGCAACG
                      ____________________________________________________________
consensus CCCCCGTAGTGGAAGAGAAGACGGAGTTCGACGTGGTGATCGAAGAGGTGCCGAGCAACG
 
. : . : . : . : . : . :
JMFF042J14- CCAGAATTGCGGCGATTAAAGCGATTCGGACTTTGACGAGCTTGGCGCTGAAAGAGGCCA
JMFF041B01- CCAGAATTGCGGCGATTAAAGCGATTCGGACTTTGACGAGCTTGGCGCTGAAAGAGGCCA
rJMFF042J14+ CCAGAATTGCGGCGATTAAAGCGATTCGGACTTTGACGAGCTTGGCGCTGAAAGAGGCCA
rJMFF041B01+ CCAGAATTGCGGCGATTAAAGCGATTCGGACTTTGACGAGCTTGGCGCTGAAAGAGGCCA
                      ____________________________________________________________
consensus CCAGAATTGCGGCGATTAAAGCGATTCGGACTTTGACGAGCTTGGCGCTGAAAGAGGCCA
 
. : . : . : . : . : . :
JMFF042J14- AGGAGTTGATTGAAGGGCTGCCGAAGAAATTCAAAGAGGGAGTCTCTANAGAGGACGCTG
JMFF041B01- AGGAGTTGATTGAAGGGCTGCCGAAGAAATTCAAAGAGGGAGTCTCTAAAGAGGACGCTG
rJMFF042J14+ AGGAGTTGATTGAAGGGCTGCCGAAGAAATTCAAAGAGGGAGTCTCTAAAGAGGACGCTG
rJMFF041B01+ AGGAGTTGATTGAAGGGCTGCCGAAGAAATTCAAAGAGGGAGTCTCTAAAGAGGACGCTG
                      ____________________________________________________________
consensus AGGAGTTGATTGAAGGGCTGCCGAAGAAATTCAAAGAGGGAGTCTCTAAAGAGGACGCTG
 
. : . : . : . : . : . :
JMFF042J14- AAGAAGCCAAAAAGCAGCTCGAAGCCGCCGGAAGCCAAGTATCAATTGTCTAGAAATTTG
JMFF041B01- AAGAAGCCAAAAAGCAGCTCGAAGCCGCCGGAGCCAAAGTATCAATTGTCTAGAAATTTG
rJMFF042J14+ AAGAAGCCAAAAAGCAGCTCGAAGCCGCCGGAGCCAAAGTATCAATTGTCTAGAAATTTG
rJMFF041B01+ AAGAAGCCAAAAAGCAGCTCGAAGCCGCCGGAGCCAAAGTATCAATTGTCTAGAAATTTG
                      ____________________________________________________________
consensus AAGAAGCCAAAAAGCAGCTCGAAGCCGCCGGAGCCAAAGTATCAATTGTCTAGAAATTTG
 
. : . : . : . : . : . :
JMFF042J14- ATTCAATCGATGA
JMFF041B01- ATTCAATCGATGAATTCCATG
rJMFF042J14+ ATTCAATCGATGAATTCCATGGCAATGCTTTCTATCTCTTTCCCTCTCCCCTTTTTTGTG
rJMFF041B01+ ATTCAATCGATGAATTCCATGGCAATGCTTTCTATCTCTTTCCCTCTCCCCTTTTTTGTG
                      ____________________________________________________________
consensus ATTCAATCGATGAATTCCATGGCAATGCTTTCTATCTCTTTCCCTCTCCCCTTTTTTGTG
 
. : . : . : . : . : . :
rJMFF042J14+ ACGAAATTTATTTGTACTTGTTTGCATTTGCTACTAGCCAGTTTCTAGCTATAGACTTAC
rJMFF041B01+ ACGAAATTTATTTGTACTTGTTTGCATTTGCTACTAGCCAGTTTCTAGCTATAGACTTAC
                      ____________________________________________________________
consensus ACGAAATTTATTTGTACTTGTTTGCATTTGCTACTAGCCAGTTTCTAGCTATAGACTTAC
 
. : . : . : . : . : . :
rJMFF042J14+ AGCTTCACATCTCTTATGTTATGATTTCTGAAGCATCAAAATCTTCATTTCTCAATC
rJMFF041B01+ AGCTTCACATCTCTTATGTTATGATTTCTGAAGCATCAAAATCTTCATTTCTCAATCTCT
                      ____________________________________________________________
consensus AGCTTCACATCTCTTATGTTATGATTTCTGAAGCATCAAAATCTTCATTTCTCAATCTCT