Previous Contig 010099:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041A02Sequence642010099 (2)619010099 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF041A02- ACAACTCACCAAAGA
                      ____________________________________________________________
consensus ACAACTCACCAAAGA
 
. : . : . : . : . : . :
JMFF041A02- AACCAAAAAACAAAAGTTGTTAAACCTTCATCACATCACCTAGACCAATACCACCATGGC
                      ____________________________________________________________
consensus AACCAAAAAACAAAAGTTGTTAAACCTTCATCACATCACCTAGACCAATACCACCATGGC
 
. : . : . : . : . : . :
JMFF041A02- AGGTTATGGCTTCACGAACAGAGGAAACTTTAACACCTACAAGGCCATGGAGCGACACAT
rJMFF041A02+ AGGCCATGGAGCGACACAT
                      ____________________________________________________________
consensus AGGTTATGGCTTCACGAACAGAGGAAACTTTAACACCTACAAGGCCATGGAGCGACACAT
 
. : . : . : . : . : . :
JMFF041A02- GGCCGGAAACTCCATCAGCGGCGGCGCTCACCGTCCGTCGTCGTACGCTCATCACGGCTA
rJMFF041A02+ GGCCGGAAACTCCATCAGCGGCGGCGCTCACCGTCCGTCGTCGTACGCTCATCACGGCTA
                      ____________________________________________________________
consensus GGCCGGAAACTCCATCAGCGGCGGCGCTCACCGTCCGTCGTCGTACGCTCATCACGGCTA
 
. : . : . : . : . : . :
JMFF041A02- TCCCGCCGCCGGTGAAAGCTTCTTAAGCATGAAGGACAACGTGGTCGCCGGCGGCGAACA
rJMFF041A02+ TCCCGCCGCCGGTGAAAGCTTCTTAAGCATGAAGGACAACGTGGTCGCCGGCGGCGAACA
                      ____________________________________________________________
consensus TCCCGCCGCCGGTGAAAGCTTCTTAAGCATGAAGGACAACGTGGTCGCCGGCGGCGAACA
 
. : . : . : . : . : . :
JMFF041A02- CCCCAGCAGCAGCAACAACAGTGTTGAACAAGACTTGTTCGAGAAGGTTCGCATGCAAAT
rJMFF041A02+ CCCCAGCAGCAGCAACAACAGTGTTGAACAAGACTTGTTCGAGAAGGTTCGCATGCAAAT
                      ____________________________________________________________
consensus CCCCAGCAGCAGCAACAACAGTGTTGAACAAGACTTGTTCGAGAAGGTTCGCATGCAAAT
 
. : . : . : . : . : . :
JMFF041A02- GTCCCAACTGAATTACCGTCGCAGGAACGGGTGGGTAAAGCCTTCCACTGGGAAGAATAA
rJMFF041A02+ GTCCCAACTGAATTACCGTCGCAGGAACGGGTGGGTAAAGCCTTCCACTGGGAAGAATAA
                      ____________________________________________________________
consensus GTCCCAACTGAATTACCGTCGCAGGAACGGGTGGGTAAAGCCTTCCACTGGGAAGAATAA
 
. : . : . : . : . : . :
JMFF041A02- TAATAATGGAGAATATGATCACAAGCCTAATGGATTGCAAACCGGAAAGTACAACTTCTA
rJMFF041A02+ TAATAATGGAGAATATGATCACAAGCCTAATGGATTGCAAACCGGAAAGTACAACTTCTA
                      ____________________________________________________________
consensus TAATAATGGAGAATATGATCACAAGCCTAATGGATTGCAAACCGGAAAGTACAACTTCTA
 
. : . : . : . : . : . :
JMFF041A02- CGCCGCTCAGGGCGGTGCTCAACGCTTCCGTTTTGGTGCTCCGGCGGCCGGCGATGTCTC
rJMFF041A02+ CGCCGCTCAGGGCGGTGCTCAACGCTTCCGTTTTGGTGCTCCGGCGGCCGGCGATGTCTC
                      ____________________________________________________________
consensus CGCCGCTCAGGGCGGTGCTCAACGCTTCCGTTTTGGTGCTCCGGCGGCCGGCGATGTCTC
 
. : . : . : . : . : . :
JMFF041A02- AGCAAAGTAGAGAGAATCGTAACTCATAAACTGATTATCTCATATATAAATTAAAGGACT
rJMFF041A02+ AGCAAAGTAGAGAGAATCGTAACTCATAAACTGATTATCTCATATATAAATTAAAGGACT
                      ____________________________________________________________
consensus AGCAAAGTAGAGAGAATCGTAACTCATAAACTGATTATCTCATATATAAATTAAAGGACT
 
. : . : . : . : . : . :
JMFF041A02- AAGAAATTAAAGAACTTTATAGTGTTTTTTACCCTATAAATAAGATATTAAGAACTAAAA
rJMFF041A02+ AAGAAATTAAAGAACTTTATAGTGTTTTTTACCTATAAAATAAGATATTAAGAACTAAAA
                      ____________________________________________________________
consensus AAGAAATTAAAGAACTTTATAGTGTTTTTTACCTTTTAAATAAGATATTAAGAACTAAAA
 
. : . : . : . : . : . :
JMFF041A02- AGTGGAGATGTGCGACTGCATCCCTCT
rJMFF041A02+ AGTGGAGATGTGCGACTGCATCCCTCTCTTATCCTAGCTAGTATTTTCATTGTATTATAC
                      ____________________________________________________________
consensus AGTGGAGATGTGCGACTGCATCCCTCTCTTATCCTAGCTAGTATTTTCATTGTATTATAC
 
. : . : . : . : . : . :
rJMFF041A02+ TGTCATTGTATAAGAGATATGTGATGTATATTTAATTATATGAAGTCTTTTAAGTTTTTG
                      ____________________________________________________________
consensus TGTCATTGTATAAGAGATATGTGATGTATATTTAATTATATGAAGTCTTTTAAGTTTTTG