Previous Contig 010089:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040M22Sequence348007176 (6)gb:AB124646_15280785e-27Nicotiana tabacum NtTPC1A mRNA for two-pore calcium channel, complete cds.672010089 (4)gb:AB124647_15280793e-56Nicotiana tabacum NtTPC1B mRNA for two-pore calcium channel, complete cds.
JMSF025C07Sequence684007176 (6)gb:AB124646_15280784e-51Nicotiana tabacum NtTPC1A mRNA for two-pore calcium channel, complete cds.764010089 (4)gb:AB124647_15280792e-74Nicotiana tabacum NtTPC1B mRNA for two-pore calcium channel, complete cds.
JMSF037N05Sequence615007176 (6)gb:AB124646_15280785e-52Nicotiana tabacum NtTPC1A mRNA for two-pore calcium channel, complete cds.670010089 (4)gb:AB124647_15280791e-59Nicotiana tabacum NtTPC1B mRNA for two-pore calcium channel, complete cds.
JMSF044A06Sequence746007176 (6)gb:AB124646_15280786e-74Nicotiana tabacum NtTPC1A mRNA for two-pore calcium channel, complete cds.747010089 (4)gb:AB124647_15280795e-80Nicotiana tabacum NtTPC1B mRNA for two-pore calcium channel, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF044A06+ ATAAGGCTCTTGATGCATGTACGAAGTTATCGTGCCTTTGTAGCAACA
                      ____________________________________________________________
consensus ATAAGGCTCTTGATGCATGTACGAAGTTATCGTGCCTTTGTAGCAACA
 
. : . : . : . : . : . :
rJMSF044A06+ TTTTTTGACTCTCATACCAAGTCTCATGCCATACTTAGGGACCATCTTCTGTGTATTGTG
rJMSF025C07+ TTTTGACTNTCATACCAAGTCTCATGCCATACTTAGGGACCATNTTCTGTGTATTGGG
                      ____________________________________________________________
consensus TTTTTTGACTCTCATACCAAGTCTCATGCCATACTTAGGGACCATCTTCTGTGTATTGTG
 
. : . : . : . : . : . :
rJMSF044A06+ CTTTTANTGCTCTCTTGGTTTACAGATCTTTGGTGGGATGGTCAATGCTGGGAACCCCAA
rJMSF025C07+ CTTTTATTGCTCTCTTGGTTTACAGATCTTTGGTGGGATGGTCAATGCTGGGAACCCCAA
rJMSF037N05+ TTTGGTGGGATGGTCAATGCTGGGAACCCCAA
rJMFF040M22+ AACCCCAA
                      ____________________________________________________________
consensus CTTTTATTGCTCTCTTGGTTTACAGATCTTTGGTGGGATGGTCAATGCTGGGAACCCCAA
 
. : . : . : . : . : . :
rJMSF044A06+ TTTAGATGGAACTGATCTTTCTGATAATGACTATTTGCTTTTCAACTTCAATGACTATCC
rJMSF025C07+ TTTAGATGGAACTGATCTTTCTGATAATGACTATTTGCTTTTCAACTTCAATGACTATCC
rJMSF037N05+ TTTAGATGGAACTGATCTTTCTGATAATGACTATTTGCTTTTCAACTTCAATGACTATCC
rJMFF040M22+ TTTAGATGGAACTGATCTTTCTGATAATGACTATTTGCTTTTCAACTTCAATGACTATCC
                      ____________________________________________________________
consensus TTTAGATGGAACTGATCTTTCTGATAATGACTATTTGCTTTTCAACTTCAATGACTATCC
 
. : . : . : . : . : . :
rJMSF044A06+ AAATGGAATGGTGACACTTTTCAATTTGTTGGTGATGGGTAACTGGCAATTGTGGATGCA
rJMSF025C07+ AAATGGAATGGTGACACTTTTCAATTTGTTGGTGATGGGTAACTGGCAATTGTGGATGCA
rJMSF037N05+ AAATGGAATGGTGACACTTTTCAATTTGTTGGTGATGGGTAACTGGCAATTGTGGATGCA
rJMFF040M22+ AAATGGAATGGTGACACTTTTCAATTTGTTGGTGATGGGTAACTGGCAATTGTGGATGCA
                      ____________________________________________________________
consensus AAATGGAATGGTGACACTTTTCAATTTGTTGGTGATGGGTAACTGGCAATTGTGGATGCA
 
. : . : . : . : . : . :
rJMSF044A06+ GAGCTACAAGGAATTGACTGGGACTTCTTGGAGTTATGTCTACTTTATCAGTTTCTATGT
rJMSF025C07+ GAGCTACAAGGAATTGACTGGGACTTCTTGGAGTTATGTCTACTTTATCAGTTTCTATGT
rJMSF037N05+ GAGCTACAAGGAATTGACTGGGACTTCTTGGAGTTATGTCTACTTTATCAGTTTCTATGT
rJMFF040M22+ GAGCTACAAGGAATTGACTGGGACTTCTTGGAGTTATGTCTACTTTATCAGTTTCTATGT
                      ____________________________________________________________
consensus GAGCTACAAGGAATTGACTGGGACTTCTTGGAGTTATGTCTACTTTATCAGTTTCTATGT
 
. : . : . : . : . : . :
rJMSF044A06+ TATCACAGTTTTATGGCTCTTGAATTTGATTGTAGCATTTGTCTTGGAGGCTTTCCAAAC
rJMSF025C07+ TATCACAGTTTTATGGCTCTTGAATTTGATTGTAGCATTTGTCTTGGAGGCTTTCCAAAC
rJMSF037N05+ TATCACAGTTTTATGGCTCTTGAATTTGATTGTAGCATTTGTCTTGGAGGCTTTCCAAAC
rJMFF040M22+ TATCACAGTTTTATGGCTCTTGAATTTGATTGTAGCATTTGTCTTGGAGGCTTTCCAAAC
                      ____________________________________________________________
consensus TATCACAGTTTTATGGCTCTTGAATTTGATTGTAGCATTTGTCTTGGAGGCTTTCCAAAC
 
. : . : . : . : . : . :
rJMSF044A06+ TGAGATGGATATGGAAACTTCAGCAATTTGTGTGGATGGAGAGAACAAGGAAGAAAGAGA
rJMSF025C07+ TGAGATGGATATGGAAACTTCAGCAATTTGTGTGGATGGAGAGAACAAGGAAGAAAGAGA
rJMSF037N05+ TGAGATGGATATGGAAACTTCAGCAATTTGTGTGGATGGAGAGAACAAGGAAGAAAGAGA
rJMFF040M22+ TGAGATGGATATGGAAACTTCAGCAATTTGTGTGGATGGAGAGAACAAGGAAGAAAGAGA
                      ____________________________________________________________
consensus TGAGATGGATATGGAAACTTCAGCAATTTGTGTGGATGGAGAGAACAAGGAAGAAAGAGA
 
. : . : . : . : . : . :
rJMSF044A06+ AAGGGAGCGACGCCGTAAGTATGGCACAAAGACAAGGAGCCAGCGAGTTGATGCCCTCCT
rJMSF025C07+ AAGGGAGCGACGCCGTAAGTATGGCACAAAGACAAGGAGCCAGCGAGTTGATGCCCTCCT
rJMSF037N05+ AAGGGAGCGACGCCGTAAGTATGGCACAAAGACAAGGAGCCAGCGAGTTGATGCCCTCCT
rJMFF040M22+ AAGGGAGCGACGCCGTAAGTATGGCACAAAGACAAGGAGCCAGCGAGTTGATGCCCTCCT
                      ____________________________________________________________
consensus AAGGGAGCGACGCCGTAAGTATGGCACAAAGACAAGGAGCCAGCGAGTTGATGCCCTCCT
 
. : . : . : . : . : . :
rJMSF044A06+ CCATCATATGCTGAGCTCTGAACTGACACAGTGCTCCAGCCCATAATTCTCTCCACTCCA
rJMSF025C07+ CCATCATATGCTGAGCTCTGAACTAACACAGTGCTCCAGCCCATAATTCTCTCCACTCCA
rJMSF037N05+ CCATCATATGCTGAGCTCTGAACTGACACAGTGCTCCAGCCCATAATTCTCTCCACTCCA
rJMFF040M22+ CCATCATATGCTGAGCTCTGAACTGACACAGTGCTCCAGCCCATAATTCTCTCCACTCCA
                      ____________________________________________________________
consensus CCATCATATGCTGAGCTCTGAACTGACACAGTGCTCCAGCCCATAATTCTCTCCACTCCA
 
. : . : . : . : . : . :
rJMSF044A06+ GGTCATGAATCCCTGACGGAGAAACCAGTACATCATTATCCACTAGGAAGTAGACCTCTC
rJMSF025C07+ GGTCATGAATCCCTGACGGAGAAACCAGTACATCATTATCCACTAGGAAGTAGACCTCTC
rJMSF037N05+ GGTCATGAATCCCTGACGGAGAAACCAGTACATCATTATCCACTAGGAAGTAGACCTCTC
rJMFF040M22+ GGTCATGAATCCCTGACGGAGAAACCAGTACATCATTATCCACTAGGAAGTAGACCTCTC
                      ____________________________________________________________
consensus GGTCATGAATCCCTGACGGAGAAACCAGTACATCATTATCCACTAGGAAGTAGACCTCTC
 
. : . : . : . : . : . :
rJMSF044A06+ GCATTAGGACGGACGTGTGCAGTTTCAGTTTGTGGATAGGCGCTTGGTGTTTAAATTATT
rJMSF025C07+ GCATTAGGACGGACGTGTGCAGTTTCAGTTTGTGGATAGGCGCTTGGTGTTTAAATTATT
rJMSF037N05+ GCATTAGGACGGACGTGTGCAGTTTCAGTTTGTGGATAGGCGCTTGGTGTTTAAATTATT
rJMFF040M22+ GCATTAGGACGGACGTGTGCAGTTTCAGTTTGTGGATAGGCGCTTGGTGTTTAAATTATT
                      ____________________________________________________________
consensus GCATTAGGACGGACGTGTGCAGTTTCAGTTTGTGGATAGGCGCTTGGTGTTTAAATTATT
 
. : . : . : . : . : . :
rJMSF044A06+ GTACCATAGTCGCTCACCATGCAAANCTGGTGATGGTAT
rJMSF025C07+ GTACCATAGTCGCTCA-CATGCAAA-CTGGTGATGGTATTATCAGGAATTCAGGACTTTT
rJMSF037N05+ GTACCATAGTCGCTCA-CATGCAAA-CTGGTGATGGTATTATCAGGAATTCAGGACTTTT
rJMFF040M22+ GTACCATAGTCGCTCA-CATGCAAA-CTGGTGATGGTATTATCAGGAATTCAGGACTTTT
                      ____________________________________________________________
consensus GTACCATAGTCGCTCA-CATGCAAA-CTGGTGATGGTATTATCAGGAATTCAGGACTTTT
 
. : . : . : . : . : . :
rJMSF025C07+ GTTGGTGAATTTGAACCAGAATATTCTCTGTTGTGACTT
rJMSF037N05+ GTTGGTGAATTTGAACCAGAATATTCTCTGTTGTGACTT
rJMFF040M22+ GTTGGTGAATTTGAACCAGAATATTCTCTGTTGTGACTTTTTCCTTCAGTTTAAAGCACA
                      ____________________________________________________________
consensus GTTGGTGAATTTGAACCAGAATATTCTCTGTTGTGACTTTTTCCTTCAGTTTAAAGCACA