Previous Contig 010086:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035L17Sequence484006607 (7)gb:AF211539_17773999e-15Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 65 (ACRE65) mRNA, complete 160010086 (2)
JMFF040M08Sequence488006607 (7)gb:AF211539_17773999e-15Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 65 (ACRE65) mRNA, complete 186010086 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF040M08+ CCNGGN
                      ____________________________________________________________
consensus CCNGGN
 
. : . : . : . : . : . :
rJMFF035L17+ TTTTTTTTTTT
rJMFF040M08+ CCCCCCNTGNANGGTNNNGNCCNTNNNGNCGGGTTCNANCCCGGGNGGNTTTTTTTTTTT
                      ____________________________________________________________
consensus CCCCCCNTGNANGGTNNNGNCCNTNNNGNCGGGTTCNANCCCGGGNGGNTTTTTTTTTTT
 
. : . : . : . : . : . :
rJMFF035L17+ TTTCGCCCGTTTGTAATTAGTGTACTAGAGTTTGAAAACACCATGACCAATCATACAGTT
rJMFF040M08+ TTTCGCCCGTTTGTAATTAGTGTACTAGAGTTTGAAAACACCATGACCAATCATACAGTT
                      ____________________________________________________________
consensus TTTCGCCCGTTTGTAATTAGTGTACTAGAGTTTGAAAACACCATGACCAATCATACAGTT
 
. : . : . : . : . : . :
rJMFF035L17+ GTAAAATCTTTTCACCAAACAAAATTTCTTTATACTCATGCCTCATCTTATACATCG
rJMFF040M08+ GTAAAATCTTTTCACCAAACAAAATTTCTTTATACTCATGCCTCATCTTATACATCGATC
                      ____________________________________________________________
consensus GTAAAATCTTTTCACCAAACAAAATTTCTTTATACTCATGCCTCATCTTATACATCGATC