Previous Contig 010084:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040L19Sequence469010084 (2)675010084 (2)pir|F84607|F846079e-68hypothetical protein At2g21990 [imported] - Arabidopsis thaliana>gb:AC007019_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF040L19- AAGAATGGCAAGATTTCAATCCATCTTCC
                      ____________________________________________________________
consensus AAGAATGGCAAGATTTCAATCCATCTTCC
 
. : . : . : . : . : . :
JMFF040L19- TTGTACAATACGAGGAGATGAGATGAGAATAACGGCCTCCATCCAACACAAAGAAGATCA
                      ____________________________________________________________
consensus TTGTACAATACGAGGAGATGAGATGAGAATAACGGCCTCCATCCAACACAAAGAAGATCA
 
. : . : . : . : . : . :
JMFF040L19- CACAACATTAAATTCCTCAAACAAAACTAACACCGATTCCGTTGAATATTCTGGGCACCA
                      ____________________________________________________________
consensus CACAACATTAAATTCCTCAAACAAAACTAACACCGATTCCGTTGAATATTCTGGGCACCA
 
. : . : . : . : . : . :
JMFF040L19- AATCAACGTAACCTCCATTCATCATTATCTATCTTTTCTTCCTCGTATGCATGGCACCCT
                      ____________________________________________________________
consensus AATCAACGTAACCTCCATTCATCATTATCTATCTTTTCTTCCTCGTATGCATGGCACCCT
 
. : . : . : . : . : . :
JMFF040L19- CCCATTGCTGGCGGTGATTATTCGGCCGTATCGGAGTCATAAAAAGCAACAATTAATATA
                      ____________________________________________________________
consensus CCCATTGCTGGCGGTGATTATTCGGCCGTATCGGAGTCATAAAAAGCAACAATTAATATA
 
. : . : . : . : . : . :
JMFF040L19- ATGGAGGAAGCAGCAACGGGGGAGCCAAGCAGGCTGAGCACCGATAGCATATCTTCCGTT
                      ____________________________________________________________
consensus ATGGAGGAAGCAGCAACGGGGGAGCCAAGCAGGCTGAGCACCGATAGCATATCTTCCGTT
 
. : . : . : . : . : . :
JMFF040L19- GCTTCAAAGCGTCCGCCGTCTCCACCGCCGTCATCCCTCGTCGAGCCCTCCGTCAGCAAG
rJMFF040L19+ TCCGTCAGCAAG
                      ____________________________________________________________
consensus GCTTCAAAGCGTCCGCCGTCTCCACCGCCGTCATCCCTCGTCGAGCCCTCCGTCAGCAAG
 
. : . : . : . : . : . :
JMFF040L19- AAGAAAGGAAACAAGCCGGAGAAGGTGTTCCGGGTGGTGAGATCCGTTTTCCGGTCGTTT
rJMFF040L19+ AAGAAAGGAAACAAGCCGGAGAAGGTGTTCCGGGTGGTGAGATCCGTTTTCCGGTCGTTT
                      ____________________________________________________________
consensus AAGAAAGGAAACAAGCCGGAGAAGGTGTTCCGGGTGGTGAGATCCGTTTTCCGGTCGTTT
 
. : . : . : . : . : . :
JMFF040L19- CCCATCATTACCCATCCCGC
rJMFF040L19+ CCCATCATTACCCATCCCGCGGTTTGCAGGTTCCCGACGCTCCCTAATGGCAGCCGGTTC
                      ____________________________________________________________
consensus CCCATCATTACCCATCCCGCGGTTTGCAGGTTCCCGACGCTCCCTAATGGCAGCCGGTTC
 
. : . : . : . : . : . :
rJMFF040L19+ CAGGAGGGGAGCCGATCCGGCGCGCGCGTCACCGGGACTCTGTTCGGGTACCGGAAGGGG
                      ____________________________________________________________
consensus CAGGAGGGGAGCCGATCCGGCGCGCGCGTCACCGGGACTCTGTTCGGGTACCGGAAGGGG
 
. : . : . : . : . : . :
rJMFF040L19+ CGCGTGAGCCTGTCGGTGCAGGAGAATCCCGGCACGCTGCCGAATCTGGTGGTGGAACTG
                      ____________________________________________________________
consensus CGCGTGAGCCTGTCGGTGCAGGAGAATCCCGGCACGCTGCCGAATCTGGTGGTGGAACTG
 
. : . : . : . : . : . :
rJMFF040L19+ GCGATGCAGACGCAGGCGCTGCAGAAGGAGATGAGCCAAGGGATGGTGCGGATCGCGCTG
                      ____________________________________________________________
consensus GCGATGCAGACGCAGGCGCTGCAGAAGGAGATGAGCCAAGGGATGGTGCGGATCGCGCTG
 
. : . : . : . : . : . :
rJMFF040L19+ GAGTGCGAGAAACGGACGGAAAAGGACAAGATGAAGCTCCTGGACGAGCCGGTTTGGTCC
                      ____________________________________________________________
consensus GAGTGCGAGAAACGGACGGAAAAGGACAAGATGAAGCTCCTGGACGAGCCGGTTTGGTCC
 
. : . : . : . : . : . :
rJMFF040L19+ ATGTTCTGCAACGGGAAGAAGATCGGGTACAGCAAGAAACGCGACGCCACCGACGAGGAC
                      ____________________________________________________________
consensus ATGTTCTGCAACGGGAAGAAGATCGGGTACAGCAAGAAACGCGACGCCACCGACGAGGAC
 
. : . : . : . : . : . :
rJMFF040L19+ CTCAGCGTCATGGAGGCGCTCAAGGTGGTGTCAATGGGGGCCGGAGTTTTGCCGTCCACT
                      ____________________________________________________________
consensus CTCAGCGTCATGGAGGCGCTCAAGGTGGTGTCAATGGGGGCCGGAGTTTTGCCGTCCACT
 
. : . : . : . : . : . :
rJMFF040L19+ AAACCCGACTCGGAGGGCCCCGACGCCGAGATCGCGTACGTGCGGGCATGTTTCGACCGG
                      ____________________________________________________________
consensus AAACCCGACTCGGAGGGCCCCGACGCCGAGATCGCGTACGTGCGGGCATGTTTCGACCGG
 
. : . : . : . : . : . :
rJMFF040L19+ ACGGTGGGATCCAAGGACTCGGAAACGCTGTACATGGTGAGCCCCGACGGCGACGCCGGA
                      ____________________________________________________________
consensus ACGGTGGGATCCAAGGACTCGGAAACGCTGTACATGGTGAGCCCCGACGGCGACGCCGGA
 
. : . : . : . : . : . :
rJMFF040L19+ CCAGAATTGAGTATTTTCTTTGTAAGGTTATGATCACACACTGCATGGAGGACAATAATC
                      ____________________________________________________________
consensus CCAGAATTGAGTATTTTCTTTGTAAGGTTATGATCACACACTGCATGGAGGACAATAATC