Previous Contig 010081:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040K15Sequence682010081 (2)pir|T09796|T097962e-63drought-induced major intrinsic protein PIPc - Craterostigma plantagineum>gb:CPP
JMSF006P13Sequence248000317 (2)260010081 (2)pir|T09796|T097962e-05drought-induced major intrinsic protein PIPc - Craterostigma plantagineum>gb:CPP

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF040K15+ GGNCTGTTCCTAGCAAGGAAAG
                      ____________________________________________________________
consensus GGNCTGTTCCTAGCAAGGAAAG
 
. : . : . : . : . : . :
rJMFF040K15+ TGTCGTTGATCCGGGCGGTGGCGTACATGGTGGCGCAGTGCCTCGGAGCCGTGGTTGGCG
                      ____________________________________________________________
consensus TGTCGTTGATCCGGGCGGTGGCGTACATGGTGGCGCAGTGCCTCGGAGCCGTGGTTGGCG
 
. : . : . : . : . : . :
rJMFF040K15+ TGGGACTGGTGAAAGCTTTAACAAAGGACTTCTTCGACACCGTGGGCGGCGGCGCCAACA
                      ____________________________________________________________
consensus TGGGACTGGTGAAAGCTTTAACAAAGGACTTCTTCGACACCGTGGGCGGCGGCGCCAACA
 
. : . : . : . : . : . :
rJMFF040K15+ CCGTCCAGCCTGGCTTCTCAAAGGGCGTGGGCTTAGTCGCTGAGATCCTCGCCACCTTTT
                      ____________________________________________________________
consensus CCGTCCAGCCTGGCTTCTCAAAGGGCGTGGGCTTAGTCGCTGAGATCCTCGCCACCTTTT
 
. : . : . : . : . : . :
rJMFF040K15+ TCCTCGTCTACACCGTCTTCTCCGCCACCGACCCCAAACGAAACGCCCGTGACTCTCACG
                      ____________________________________________________________
consensus TCCTCGTCTACACCGTCTTCTCCGCCACCGACCCCAAACGAAACGCCCGTGACTCTCACG
 
. : . : . : . : . : . :
rJMFF040K15+ TTCCGGTATTGGCACCACTGCCCATTGGTTTTGCTGTGTTTGTGGCTCATGTCGCCACCA
                      ____________________________________________________________
consensus TTCCGGTATTGGCACCACTGCCCATTGGTTTTGCTGTGTTTGTGGCTCATGTCGCCACCA
 
. : . : . : . : . : . :
rJMFF040K15+ TTCCCATCACCGGCACCGGCATCAACCCAGCAAGGAGTTTCGGCGCTGCTGTGATCCACA
                      ____________________________________________________________
consensus TTCCCATCACCGGCACCGGCATCAACCCAGCAAGGAGTTTCGGCGCTGCTGTGATCCACA
 
. : . : . : . : . : . :
rJMSF006P13+ GTTGGGCCAATGCTGGGAGCAA
rJMFF040K15+ ACAACAAACATGCCTGGGATGACCACTGGATTTTCTGGGTTGGGCCAATGCTGGGAGCAA
                      ____________________________________________________________
consensus ACAACAAACATGCCTGGGATGACCACTGGATTTTCTGGGTTGGGCCAATGCTGGGAGCAA
 
. : . : . : . : . : . :
rJMSF006P13+ TTGCTGGAGCAGTGTATCATCAGCTAGTACTCCGAGCCCAGGCTGTTAAAGCTCTNGGTG
rJMFF040K15+ TTGCTGGAGCAGTGTATCATCAGGTAGTACTCCGAGCCCAGGCTGTTAAAGCTCTTGGTG
                      ____________________________________________________________
consensus TTGCTGGAGCAGTGTATCATCAGGTAGTACTCCGAGCCCAGGCTGTTAAAGCTCTTGGTG
 
. : . : . : . : . : . :
rJMSF006P13+ GTTCATTCCAAAGCACCCCTAACGTTTGATCTGCCATATATTATCCATATGATCTGATCA
rJMFF040K15+ GTTCATTCCAAAGCACCCCTAACGTTTGATCTGCCATATATTATCCATATGATCTGATCA
                      ____________________________________________________________
consensus GTTCATTCCAAAGCACCCCTAACGTTTGATCTGCCATATATTATCCATATGATCTGATCA
 
. : . : . : . : . : . :
rJMSF006P13+ TCATTTGTATCAATCAAATCTNGTATTGTTGTGTGCTACCATTTAGCTGATCATCATATC
rJMFF040K15+ TCATTTGTATCAATCAAATCTTGTATTGTTGTGTGCTACCATTTAGCTGATCATCATATC
                      ____________________________________________________________
consensus TCATTTGTATCAATCAAATCTTGTATTGTTGTGTGCTACCATTTAGCTGATCATCATATC
 
. : . : . : . : . : . :
rJMSF006P13+ ATCATATNTATGTAANGTGTTTTTACAATGATCTTGTCAGACTCCTTTTG
rJMFF040K15+ ATTATATATATGTAATGTGTTTTTACAATGATCTAGTCAGACTCCTTTTGNTANGGTAAC
                      ____________________________________________________________
consensus ATTATATATATGTAATGTGTTTTTACAATGATCTTGTCAGACTCCTTTTGNTANGGTAAC