Previous Contig 010080:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017C16Sequence147004356 (6)797010080 (11)sp|P49972|SR52_LYCES4e-85Signal recognition particle 54 kDa protein 2 (SRP54).>pir|S51598|S51598 signal r
JMFF025I13Sequence156004356 (6)663010080 (11)sp|P49972|SR52_LYCES1e-58Signal recognition particle 54 kDa protein 2 (SRP54).>pir|S51598|S51598 signal r
JMFF040K12Sequence147004356 (6)753010080 (11)sp|P49972|SR52_LYCES6e-77Signal recognition particle 54 kDa protein 2 (SRP54).>pir|S51598|S51598 signal r
JMFF048P02Sequence441015097sp|P49972|SR52_LYCES1e-37Signal recognition particle 54 kDa protein 2 (SRP54).>pir|S51598|S51598 signal r443010080 (11)gb:ATU12127_15567542e-29Arabidopsis thaliana clone SRP-54C signal recognition particle 54 kDa subunit (S
JMFF050K01Sequence632010080 (11)sp|P49972|SR52_LYCES1e-74Signal recognition particle 54 kDa protein 2 (SRP54).>pir|S51598|S51598 signal r609021906sp|P49972|SR52_LYCES4e-40Signal recognition particle 54 kDa protein 2 (SRP54).>pir|S51598|S51598 signal r
JMSF001M23Sequence147004356 (6)682010080 (11)sp|P49972|SR52_LYCES2e-78Signal recognition particle 54 kDa protein 2 (SRP54).>pir|S51598|S51598 signal r
JMSF017D13Sequence149004356 (6)735010080 (11)sp|P49972|SR52_LYCES1e-78Signal recognition particle 54 kDa protein 2 (SRP54).>pir|S51598|S51598 signal r
JMSF018K19Sequence264001946 (2)gb:AY102117_15777249e-13Arabidopsis thaliana AT5g47500/MNJ7_9 mRNA, complete cds.>gb:BT000565_1634843 Ar629010080 (11)sp|P49972|SR52_LYCES1e-67Signal recognition particle 54 kDa protein 2 (SRP54).>pir|S51598|S51598 signal r
JMSF023H04Sequence676010080 (11)sp|P49972|SR52_LYCESe-116Signal recognition particle 54 kDa protein 2 (SRP54).>pir|S51598|S51598 signal r721010080 (11)sp|P49972|SR52_LYCES2e-73Signal recognition particle 54 kDa protein 2 (SRP54).>pir|S51598|S51598 signal r
JMSF051I22Sequence145004356 (6)729010080 (11)sp|P49972|SR52_LYCES4e-92Signal recognition particle 54 kDa protein 2 (SRP54).>pir|S51598|S51598 signal r

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050K01- AGTTCAGTTTAATTAATTGGCAGGGCGCCGGAGGCTGGAGATATTGTGAGTCGGAGG
                      ____________________________________________________________
consensus AGTTCAGTTTAATTAATTGGCAGGGCGCCGGAGGCTGGAGATATTGTGAGTCGGAGG
 
. : . : . : . : . : . :
JMFF050K01- AGGTCGCATCCTGATCGCCGGCGCCGGGGACATAAATTTXXXXXXXXXXXXXXXXXXXXX
                      ____________________________________________________________
consensus AGGTCGCATCCTGATCGCCGGCGCCGGGGACATAAATTTNNNNNNNNNNNNNNNNNNNNN
 
. : . : . : . : . : . :
JMFF050K01- XXXXXXXXXXXXXXXXXXXXXXXXXXXTATCATCCTCGGATTCTGAATTTCAGCATTCGT
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNNNNNNNNNTATCATCCTCGGATTCTGAATTTCAGCATTCGT
 
. : . : . : . : . : . :
JMFF050K01- CAATCAAGATGGTGTTGGCGCAGCTAGGAGGGAGCATTTCGCGTGCTCTCCAGCAGATGA
                      ____________________________________________________________
consensus CAATCAAGATGGTGTTGGCGCAGCTAGGAGGGAGCATTTCGCGTGCTCTCCAGCAGATGA
 
. : . : . : . : . : . :
JMFF050K01- GCAATGCCACCATCATCGACGAGAAGGTTCTCAACGATTGCCTCAACGAGATCACTCGCG
                      ____________________________________________________________
consensus GCAATGCCACCATCATCGACGAGAAGGTTCTCAACGATTGCCTCAACGAGATCACTCGCG
 
. : . : . : . : . : . :
JMFF050K01- CTCTTCTGCAGGCCGATGTTCAGTTCAAGCTGGTCCGCGATATGCAGACCAACATCAAGC
                      ____________________________________________________________
consensus CTCTTCTGCAGGCCGATGTTCAGTTCAAGCTGGTCCGCGATATGCAGACCAACATCAAGC
 
. : . : . : . : . : . :
JMFF050K01- GGATCGTCAACCTTGACGACCTCGCCGCCGGACACAACAAGCGTAAGATCATCCAACAGG
                      ____________________________________________________________
consensus GGATCGTCAACCTTGACGACCTCGCCGCCGGACACAACAAGCGTAAGATCATCCAACAGG
 
. : . : . : . : . : . :
JMFF050K01- CTGTATTTAATGAGCTTTGCAAGATTTTGGATCCTGGAAAACCATCGTTCACACCAAAGA
                      ____________________________________________________________
consensus CTGTATTTAATGAGCTTTGCAAGATTTTGGATCCTGGAAAACCATCGTTCACACCAAAGA
 
. : . : . : . : . : . :
JMFF050K01- AAGGGAAGACTAGTGTTGTCATGTTTGTAGGTTTGCAAGGTTCTGGGAAAACAACAACAT
JMSF023H04- CAAGGTTCTGGGAAAACAACAACAT
                      ____________________________________________________________
consensus AAGGGAAGACTAGTGTTGTCATGTTTGTAGGTTTGCAAGGTTCTGGGAAAACAACAACAT
 
. : . : . : . : . : . :
JMFF050K01- GTACAAAATATGCCTACTACCACCANAGGAAGGGCTGGAAACCGGCTCTAGTTTGTGCGG
JMSF023H04- GTACAAAATATGCCTACTACCACCAAAGGAAGGGCTGGAAACCGGCTCTAGTTTGTGCGG
                      ____________________________________________________________
consensus GTACAAAATATGCCTACTACCACCAAAGGAAGGGCTGGAAACCGGCTCTAGTTTGTGCGG
 
. : . : . : . : . : . :
JMFF050K01- ATACATTCAGAGCTGGTGCTTTTGATCA
JMSF023H04- ATACATTCAGAGCTGGTGCTTTTGATCAATTGAAGCAGAATGCAACCAAAGCTAAAATAC
                      ____________________________________________________________
consensus ATACATTCAGAGCTGGTGCTTTTGATCAATTGAAGCAGAATGCAACCAAAGCTAAAATAC
 
. : . : . : . : . : . :
JMSF023H04- CTTTTTATGGGAGCTACACAGAGTCTGACCCTGTAAAGATAGCAGTGGAAGGTGTTGAAA
                      ____________________________________________________________
consensus CTTTTTATGGGAGCTACACAGAGTCTGACCCTGTAAAGATAGCAGTGGAAGGTGTTGAAA
 
. : . : . : . : . : . :
JMSF023H04- GATTCAAGAAGGAAAATTGTGATCTCATAATTGTTGACACCAGTGGGCGCCACAAACAAG
                      ____________________________________________________________
consensus GATTCAAGAAGGAAAATTGTGATCTCATAATTGTTGACACCAGTGGGCGCCACAAACAAG
 
. : . : . : . : . : . :
JMSF023H04- AAGCTGCTCTCTTTGAAGAGATGCGTCAAGTATCTGAAGCAACGAAACCGGATCTTGCGA
                      ____________________________________________________________
consensus AAGCTGCTCTCTTTGAAGAGATGCGTCAAGTATCTGAAGCAACGAAACCGGATCTTGCGA
 
. : . : . : . : . : . :
JMSF023H04- TATTTGTAATGGATAGCAGTATTGGTCAAGCTGCTTTTGATTAAGCTCAGGCATTCAAAC
                      ____________________________________________________________
consensus TATTTGTAATGGATAGCAGTATTGGTCAAGCTGCTTTTGATTAAGCTCAGGCATTCAAAC
 
. : . : . : . : . : . :
JMSF023H04- AAAGTGTTGCAGTTGGAGCAGTAATAGTTACTAAAATGGATGGCCACGCAAAGGGAGGTG
                      ____________________________________________________________
consensus AAAGTGTTGCAGTTGGAGCAGTAATAGTTACTAAAATGGATGGCCACGCAAAGGGAGGTG
 
. : . : . : . : . : . :
JMSF023H04- GTGCTCTTAGTGCAGTTGCTGCAACAAAAAGTCCTGTTATCTTTATTGGTACTGGAGAGC
                      ____________________________________________________________
consensus GTGCTCTTAGTGCAGTTGCTGCAACAAAAAGTCCTGTTATCTTTATTGGTACTGGAGAGC
 
. : . : . : . : . : . :
JMSF023H04- ACATGGATGAATTTGAAGTTTTTGATGTTAAGCCATTTGTCAGCCGACTTCTGGGCATGG
                      ____________________________________________________________
consensus ACATGGATGAATTTGAAGTTTTTGATGTTAAGCCATTTGTCAGCCGACTTCTGGGCATGG
 
. : . : . : . : . : . :
JMSF023H04- GTGATTGGTCTGGGTTCATGGACAAAATTCATGAGGTTGTTCCTATGGATCAACAGCCTG
rJMSF051I22+ GGGTTCATGGACAAAATTCATGAGGTTGTTCCTATGGATCAACAGCCTG
rJMFF017C16+ CCTATGGATCANCAGCCTG
                      ____________________________________________________________
consensus GTGATTGGTCTGGGTTCATGGACAAAATTCATGAGGTTGTTCCTATGGATCAACAGCCTG
 
. : . : . : . : . : . :
JMSF023H04- AGCTTCTCCNAAAGCTCTCTGAGGGGAATTTTACCTTGAGGATTATGTATG
rJMSF051I22+ AGCTTCTCCAAAAGCTCTCTGAGGGGAATTTTACCTTGAGGATTATGTATGAACAATTCC
rJMSF017D13+ CTCTGAGGGGAATTTTACCTTGAGGATTATGTATGAACAATTCC
rJMSF001M23+ CTCTGAGGGGAATTTTACCTTGAGGATTATGTATGAACAATTCC
rJMFF017C16+ AGCTTCTCCAAAAGCTCTCTGAGGGGAATTTTACCTTGAGGATTATGTATGAACAATTCC
rJMSF023H04+ TTGAGGATTATGTATGAACAATTCC
rJMSF018K19+ TGAGGATTATGTNTGANCANTTCC
rJMFF040K12+ AATTTTACCTTGAGGATTATGTATGAACAATTCC
                      ____________________________________________________________
consensus AGCTTCTCCAAAAGCTCTCTGAGGGGAATTTTACCTTGAGGATTATGTATGAACAATTCC
 
. : . : . : . : . : . :
rJMSF051I22+ AAAATATACTTAAAATGGGTCCTATTGGCCAGGTGTTCTCTATGCTTCCAGGATTTAGTC
rJMSF017D13+ AAAATATACTTAAAATGGGTCCTATTGGCCAGGTGTTCTCTATGCTTCCAGGATTTAGTC
rJMSF001M23+ AAAATATACTTAAAATGGGTCCTATTGGCCAGGTGTTCTCTATGCTTCCAGGATTTAGTC
rJMFF017C16+ AAAATATACTTAAAATGGGTCCTATTGGCCAGGTGTTCTCTATGCTTCCAGGATTTAGTC
rJMSF023H04+ AAAATATACTTAAAATGGGTCCTATTGGCCAGGTGTTCTCTATGCTTCCAGGATTTAGTC
rJMFF025I13+ TAGTC
rJMSF018K19+ AAAATATACTTAAAATGGGTCTTATTGGCCAGGTGTTCTCTATGCTTNCAGGATNTAGTC
rJMFF040K12+ AAAATATACTTAAAATGGGTCCTATTGGCCAGGTGTTCTCTATGCTTCCAGGATTTAGTC
                      ____________________________________________________________
consensus AAAATATACTTAAAATGGGTCCTATTGGCCAGGTGTTCTCTATGCTTCCAGGATTTAGTC
 
. : . : . : . : . : . :
rJMSF051I22+ AAGAATTAATGCCAAAAGGCCGGGAGAAGGAAAGCCAAGCAAAAATTAAACGTTATATGA
rJMSF017D13+ AAGAATTAATGCCAAAAGGCCGGGAGAAGGAAAGCCAAGCAAAAATTAAACGTTATATGA
rJMSF001M23+ AAGAATTAATGCCAAAAGGCCGGGAGAAGGAAAGCCAAGCAAAAATTAAACGTTATATGA
rJMFF017C16+ AAGAATTAATGCCAAAAGGCCGGGAGAAGGAAAGCCAAGCAAAAATTAAACGTTATATGA
rJMSF023H04+ AAGAATTAATGCCAAAAGGCCGGGAGAAGGAAAGCCAAGCAAAAATTAAACGTTATATGA
rJMFF025I13+ AAGAATTAATGCCAAAAGNCCGGGAGAAGGAAAGCCAAGCAAAAATTAAACGTTATATGA
rJMSF018K19+ AAGAATTAATNCCAAAAGGCCGGGAGAAGGAAAGCCAAGCAAAAATTAAACGTTATATGN
rJMFF040K12+ AAGAATTAATGCCAAAAGGCCGGGAGAAGGAAAGCCAAGCAAAAATTAAACGTTATATGA
                      ____________________________________________________________
consensus AAGAATTAATGCCAAAAGGCCGGGAGAAGGAAAGCCAAGCAAAAATTAAACGTTATATGA
 
. : . : . : . : . : . :
rJMSF051I22+ CAATGATGGATTCGATGACCAATGAAGAATTGGACAGTACAAACCCAAAGCTTATGACTG
rJMSF017D13+ CAATGATGGATTCGATGACCAATGAAGAATTGGACAGTACAAACCCAAAGCTTATGACTG
rJMSF001M23+ CAATGATGGATTCGATGACCAATGAAGAATTGGACAGTACAAACCCAAAGCTTATGACTG
rJMFF017C16+ CAATGATGGATTCGATGACCAATGAAGAATTGGACAGTACAAACCCAAAGCTTATGACTG
rJMSF023H04+ CAATGATGGATTCGATGACCAATGAAGAATTGGACAGTACAAACCCAAAGCTTATGACTG
rJMFF025I13+ CAATGATGGATTCGATGACCAATGAAGAATTGGACAGTACAAACCCAAAGCTTATGACTG
rJMSF018K19+ CAATGATGGATTCGATGACCAATGAAGAATTGGACAGTACAAACCCAAAGCTTATGACTG
rJMFF040K12+ CAATGATGGATTCGATGACCAATGAAGAATTGGACAGTACAAACCCAAAGCTTATGACTG
                      ____________________________________________________________
consensus CAATGATGGATTCGATGACCAATGAAGAATTGGACAGTACAAACCCAAAGCTTATGACTG
 
. : . : . : . : . : . :
rJMSF051I22+ AATCACGCATCATGCGGGTAGCAAGGGGATCTGGCCGTCTGGTGCACGAAGTGATGGAAA
rJMSF017D13+ AATCACGCATCATGCGGGTAGCAAGGGGATCTGGCCGTCTGGTGCACGAAGTGATGGAAA
rJMSF001M23+ AATCACGCATCATGCGGGTAGCAAGGGGATCTGGCCGTCTGGTGCACGAAGTGATGGGAA
rJMFF017C16+ AATCACGCATCATGCGGGTAGCAAGGGGATCTGGCCGTCTGGTGCACGAAGTGATGGAAA
rJMSF023H04+ AATCACGCATCATGCGGGTAGCAAGGGGATCTGGCC-TCTGGTGCACGAAGTGATGGAAA
rJMFF048P02+ GTGATGGAAA
rJMFF025I13+ AATCACGCATCATGCGGGTAGCAAGGGGATCTGGCCGTCTGGTGCACGAAGTGATGGAAA
rJMSF018K19+ ANTCACGCATCATGCGGGTAGCAAGGGGATCTGGCCGTCTGGTGCACGAAGTGATGGAAN
rJMFF040K12+ AATCACGCATCATGCGGGTAGCAAGGGGATCTGGCCGTCTGGTGCACGAAGTGATGGAAA
                      ____________________________________________________________
consensus AATCACGCATCATGCGGGTAGCAAGGGGATCTGGCCGTCTGGTGCACGAAGTGATGGAAA
 
. : . : . : . : . : . :
rJMSF051I22+ TGATGGAAGAGTACAAGCGGCTTGCCAAGATATGGAGCAAGATGAAGGGACTTAAAATTC
rJMSF017D13+ TGATGGAAGAGTACAAGCGGCTTGCCAAGATATGGAGCAAGATGAAGGGACTTAAAATTC
rJMSF001M23+ TGATGGAAGAGTACAAGCGGCTTGCCAAGATATGGAGCAAGATGAAGGGACTTAAAATTC
rJMFF017C16+ TGATGGAAGAGTACAAGCGGCTTGCCAAGATATGGAGCAAGATGAAGGGACTTAAAATTC
rJMSF023H04+ TGATGGAAGAGTACAAGCGGCTTGCCAAGATATGGAGCAAGATGAAGGGACTTAAAATTC
rJMFF048P02+ TGATGGAAGAGTACAAGCGGCTNGCCAAGATATGGAGCAAGATGAAGGGACTTAAAATTC
rJMFF025I13+ TGATGGAAGAGTACAAGCGGCTTGCCAAGATATGGAGCAAGATGAAGGGACTTAAAATTC
rJMSF018K19+ TGATGGAAGAGTACAAGCGGCTTGCCAAGATATGGAGCAAGATGAAGGGACTTAAAATTC
rJMFF040K12+ TGATGGAAGAGTACAAGCGGCTTGCCAAGATATGGAGCAAGATGAAGGGACTTAAAATTC
                      ____________________________________________________________
consensus TGATGGAAGAGTACAAGCGGCTTGCCAAGATATGGAGCAAGATGAAGGGACTTAAAATTC
 
. : . : . : . : . : . :
rJMSF051I22+ CAAAGAAAGGAGATATGAGCGCCTTATCCCGAAATATGAATGCACAGCACATGAGCAAAG
rJMSF017D13+ CAAAGAAAGGAGATATGAGCGCCTTATCCCGAAATATGAATGCACAGCACATGAGCAAAG
rJMSF001M23+ CAAAGAAAGGAGATATGAGCGCCTTATCCCGAAATATGAATGCACAGCACATGAGCAAAG
rJMFF017C16+ CAAAGAAAGGAGATATGAGCGCCTTATCCCGAAATATGAATGCACAGCACATGAGCAAAG
rJMSF023H04+ CAAAGAAAGGAGATATGAGCGCCTTATCCCGAAATATGAATGCACAGCACATGAGCAAAG
rJMFF048P02+ CAAAGAAAGGAGATATGAGCGCCTTATCCCGAAATATGAATGCACAGCACATGAGCAAAG
rJMFF025I13+ CAAAGAAAGGAGATATGAGCGCCTTATCCCGAAATATGAATGCACAGCACATGAGCAAAG
rJMSF018K19+ CAAAGAAAGGAGATATGAGCGCCTTATCCCGAAATATGAATGCACAGCACATGAGCAAAG
rJMFF040K12+ CAAAGAAAGGAGATATGAGCGCCTTATCCCGAAATATGAATGCACAGCACATGAGCAAAG
                      ____________________________________________________________
consensus CAAAGAAAGGAGATATGAGCGCCTTATCCCGAAATATGAATGCACAGCACATGAGCAAAG
 
. : . : . : . : . : . :
rJMSF051I22+ TTCTTCCCCCACAGATGTTGAAACAGATAGGTGGCATGGGTGGCTTACAAAGCTTGATGA
rJMSF017D13+ TTCTTCCCCCACAGATGTTGAAACAGATAGGTGGCATGGGTGGCTTACAAAGCTTGATGA
rJMSF001M23+ TTCTTCCCCCACAGATGTTGAAACAGATAGGTGGCATGGGTGGCTTACAAAGCTTGATGA
rJMFF017C16+ TTCTTCCCCCACAGATGTTGAAACAGATAGGTGGCATGGGTGGCTTACAAAGCTTGATGA
rJMSF023H04+ TTCTTCCCCCACAGATGTTGAAACAGATAGGTGGCATGGGTGGCTTACAAAGCTTGATGA
rJMFF048P02+ TTCTTCCCCCACAGATGTTGAAACAGATAGGTGGCATGGGTGGCTTACAAAGCTTGATGA
rJMFF025I13+ TTCTTCCCCCACAGATGTTGAAACAGATAGGTGGCATGGGTGGCTTACAAAGCTTGATGA
rJMSF018K19+ TTCTTCCCCCACAGATGTTGAAACAGATAGGTGGCATGGGTGGCTTACAAAGCTTGATGA
rJMFF040K12+ TTCTTCCCCCACAGATGTTGAAACAGATAGGTGGCATGGGTGGCTTACAAAGCTTGATGA
                      ____________________________________________________________
consensus TTCTTCCCCCACAGATGTTGAAACAGATAGGTGGCATGGGTGGCTTACAAAGCTTGATGA
 
. : . : . : . : . : . :
rJMSF051I22+ AACAAATGGGTTCTTCCAAGGATATGATGGGTATGTTTGGTGGTGGGGATAAGTAAATTC
rJMSF017D13+ AACAAATGGGTTCTTCCAAGGATATGATGGGTATGTTTGGTGGTGGGGATAAGTAAATTC
rJMSF001M23+ AACAAATGGGTTCTTCCAAGGATATGATGGGTATGTTTGGTGGTGGGGATAAGTAAATTC
rJMFF017C16+ AACAAATGGGTTCTTCCAAGGATATGATGGGTATGTTTGGTGGTGGGGATAAGTAAATTC
rJMSF023H04+ AACAAATGGGTTCTTCCAAGGATAT-ATGGGTATGTTTGGTGGTGGGGATAAGTAAATTC
rJMFF048P02+ AACAAATGGGTTCTTCCAAGGATATGATGGGTATGTTTGGTGGTGGGGATAAGTAAATTC
rJMFF025I13+ AACAAATGGGTTCTTCCAAGGATATGATGGGTATGTTTGGTGGTGGGGATAAGTAAATTC
rJMSF018K19+ AACAAATGGGTTCTTCCAAGGATATGATGGGTATGTTTGGTGGTGGGGANAAGTAAATTC
rJMFF040K12+ AACAAATGGGTTCTTCCAAGGATATGATGGGTATGTTTGGTGGTGGGGATAAGTAAATTC
                      ____________________________________________________________
consensus AACAAATGGGTTCTTCCAAGGATATGATGGGTATGTTTGGTGGTGGGGATAAGTAAATTC
 
. : . : . : . : . : . :
rJMSF051I22+ TCACATATTAAACCTGATTGTAGGCCTACAATTCAAGCAAGCCTACCTGGATAAGGAGTA
rJMSF017D13+ TCACATATTAAACCTGATTGTAGGCCTACAATTCAAGCAAGCCTACCTGGATAAGGAGTA
rJMSF001M23+ TCACATATTAAACCTGATTGTAGGCCTACAATTCAAGCAAGCCTACCTGGATAAGGAGTA
rJMFF017C16+ TCACATATTAAACCTGATTGTAGGCCTACAATTCAAGCAAGCCTACCTGGATAAGGAGNA
rJMSF023H04+ TCACATATTAAACCTGATTGTAGGCCTACAATTCAAGCAAGCCTACCTGGATAAGGAGTA
rJMFF048P02+ TCACATATTAAACCTGATTGTAGGCCTACAATTCAAGCAAGCCTACCTGGATAAGGAGTA
rJMFF025I13+ TCACATATTAAACCTGATTGTAGGCCTACAATTCAAGCAAGCCTACCTGGATAAGGAGTA
rJMSF018K19+ TCACATATTAAACCTGATTGTNGGCCTACAANTCAAGCAAGCCTACCTGGATAAGGAGTA
rJMFF040K12+ TCACATATTAAACCTGATTGTAGGCCTACAATTCAAGCAAGCCTACCTGGATAAGGAGTA
                      ____________________________________________________________
consensus TCACATATTAAACCTGATTGTAGGCCTACAATTCAAGCAAGCCTACCTGGATAAGGAGTA
 
. : . : . : . : . : . :
rJMSF051I22+ CAATTTCTTTCTTTTCCTATTTTCTGTTCCTTAACAGAATTCTCACTACTGTAATTTCTT
rJMSF017D13+ CAATTTCTTTCTTTTCCTATTTTCTGTTCCTTAACAGAATTCTCACTACTGTAATTTCTT
rJMSF001M23+ CAATTTCTTTCTTTTCCTATTTTCTGTTCCTTAACAGAATTCTCACTACTGTAATTTCTT
rJMFF017C16+ CAATTTCTTTCTTTTCCTATTTTCTGTTCCTTAACAGAATTCTCACTACTGTAATTTCTT
rJMSF023H04+ CAATTTCTTTCTTTTCCTATTTTCTGTTCCTTAACAGAATTCTCACTACTGTAATTTCTT
rJMFF048P02+ CAATTTCTTTCTTTTCCTATTTTCTGTTCCTTAACAGAATTCTCACTACTGTAATTTCTT
rJMFF025I13+ CAATTTCTTTCTTTTCCTATTTTCTGTTCCTTAACAGAATTCTCACTACTGTAATTTCTT
rJMSF018K19+ CAATTTCTTTCTTTTCCTATTTTCTGTTCCTTAACAGAATTCTCACTACTGTAATTTCTT
rJMFF040K12+ CAATTTCTTTCTTTTCCTATTTTCTGTTCCTTAACAGAATTCTCACTACTGTAATTTCTT
                      ____________________________________________________________
consensus CAATTTCTTTCTTTTCCTATTTTCTGTTCCTTAACAGAATTCTCACTACTGTAATTTCTT
 
. : . : . : . : . : . :
rJMSF051I22+ AGTATACTAGTACTTAGTTT
rJMSF017D13+ AGTATACTAGTACTTAGTTTTGT-GCCATGTGAATATATGTACCAAGGTGTATGGCTATG
rJMSF001M23+ AGTATACTAGTACTTAGTTTTGTNCCCATGTGAATATA
rJMFF017C16+ AGTATACTAGTACTTAGTTTTGT-GCCATGTGAATATATGTACCAAGGTGTATGGCTATG
rJMSF023H04+ AGTATACTAGTACTTAGTTTTGT-GCCATGTGAATATATGTACCAAGGTGTATGGCTATG
rJMFF048P02+ AGTATACTAGTACTTAGTTTTGT-GCCATGTGAATATATGTACCAAGGTGTATGGCTATG
rJMFF025I13+ AGTATACTAGTACTTAGTTTTGT-GCCATGTGAATATATGTACCAAGGTGTATGGCTATG
rJMSF018K19+ AGTAT
rJMFF040K12+ AGTATACTAGTACTTAGTTTTGT-GCCATGTGAATATATGTACCAAGGTGTATGGCTATG
                      ____________________________________________________________
consensus AGTATACTAGTACTTAGTTTTGT-GCCATGTGAATATATGTACCAAGGTGTATGGCTATG
 
. : . : . : . : . : . :
rJMSF017D13+ GATCAATTTGCAGCTTCTAATTTTTCTACTTT
rJMFF017C16+ GATCAATTTGCAGCTTCTAATTTTTCTACTTTTTCCTGCCTAAGCAGCAACAATGCAAT
rJMSF023H04+ GATCAATTTGCAGCTTCTAATTTTTCTACTTTTTCCTGC
rJMFF048P02+ GATCAATTTGCAGC
rJMFF025I13+ GATCAATTTGCAGCTTCTAATTTTTCTACTTTTTCCTGCCTAAGCAGCAACAATGCAAT
rJMFF040K12+ GATCAATTTGCAGCTTCTAATTTTTCTACTTTTTCCTGCCTAAGCAGCAACAATGCAATG
                      ____________________________________________________________
consensus GATCAATTTGCAGCTTCTAATTTTTCTACTTTTTCCTGCCTAAGCAGCAACAATGCAATG