Previous Contig 010076:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040I09Sequence510010076 (2)gb:AY568722_16154801e-38Lycopersicon esculentum chloroplast-specific ribosomal protein mRNA, complete cd717010076 (2)gb:AY568722_16154804e-69Lycopersicon esculentum chloroplast-specific ribosomal protein mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF040I09- CCGTTCCAATCGCAAGAAATCTCGTCATAGAA
                      ____________________________________________________________
consensus CCGTTCCAATCGCAAGAAATCTCGTCATAGAA
 
. : . : . : . : . : . :
JMFF040I09- ATGGCGACTCTTTCCATATCTTCAACCGCTAGAGCGTTTTCTTGCTCTTCCTGCTACTCT
                      ____________________________________________________________
consensus ATGGCGACTCTTTCCATATCTTCAACCGCTAGAGCGTTTTCTTGCTCTTCCTGCTACTCT
 
. : . : . : . : . : . :
JMFF040I09- CCGTCTTCTTCCCCTTCCTCGTCAACGCTCTCTTTATCCAAAAAGCTTAAATTTTTATCG
                      ____________________________________________________________
consensus CCGTCTTCTTCCCCTTCCTCGTCAACGCTCTCTTTATCCAAAAAGCTTAAATTTTTATCG
 
. : . : . : . : . : . :
JMFF040I09- TCTTCTTCGAGCAGTTTTCTTGCTTCGAGCTTCAAGATCAGTGAGAGTAGTAATGTCCCA
                      ____________________________________________________________
consensus TCTTCTTCGAGCAGTTTTCTTGCTTCGAGCTTCAAGATCAGTGAGAGTAGTAATGTCCCA
 
. : . : . : . : . : . :
JMFF040I09- CCCAGAAAACCGATGGGGATTCGGATGGCTTGGGATGGCCCTCTCTCTTCCGTCAAACTC
                      ____________________________________________________________
consensus CCCAGAAAACCGATGGGGATTCGGATGGCTTGGGATGGCCCTCTCTCTTCCGTCAAACTC
 
. : . : . : . : . : . :
JMFF040I09- ATTATCCAAACCAAACACATTGAGTTAACACCTAATGTGAGGAGCTATGTGGAGGAGAAA
                      ____________________________________________________________
consensus ATTATCCAAACCAAACACATTGAGTTAACACCTAATGTGAGGAGCTATGTGGAGGAGAAA
 
. : . : . : . : . : . :
JMFF040I09- TTGGGTAAGGCAGTTCAAAAGCATAGCCATCTGGTGAGGGAAGTGGATGCTAGGTTGTCT
                      ____________________________________________________________
consensus TTGGGTAAGGCAGTTCAAAAGCATAGCCATCTGGTGAGGGAAGTGGATGCTAGGTTGTCT
 
. : . : . : . : . : . :
JMFF040I09- GTTCGTGGGGGCGAGTTTGGGAAAGGCCCAAAAGTTCAAAGATCTGAGGTGACTTTGTAC
rJMFF040I09+ CGTGGGGGCGAGTTTGGGAAAGGCCCAAAAGTTCAAAGATCTGAGGTGACTTTGTAC
                      ____________________________________________________________
consensus GTTCGTGGGGGCGAGTTTGGGAAAGGCCCAAAAGTTCAAAGATCTGAGGTGACTTTGTAC
 
. : . : . : . : . : . :
JMFF040I09- ACGAAGAAGCATGGAGTTGTTCGTGCAGAGGTGGATGCGGAGACACTGTATGGGAGTG
rJMFF040I09+ ACGAAGAAGCATGGAGTTGTTCGTGCAGAGGTGGATGCGGAGACACTGTATGGGAGTGTG
                      ____________________________________________________________
consensus ACGAAGAAGCATGGAGTTGTTCGTGCAGAGGTGGATGCGGAGACACTGTATGGGAGTGTG
 
. : . : . : . : . : . :
rJMFF040I09+ GACATGGTCTCGTCAGTTATACAGAGAAAACTGCGGAAGATTAAGGAGAAAGATTCTGAT
                      ____________________________________________________________
consensus GACATGGTCTCGTCAGTTATACAGAGAAAACTGCGGAAGATTAAGGAGAAAGATTCTGAT
 
. : . : . : . : . : . :
rJMFF040I09+ CATGGTCGGCATATGAAGGGCTTTGACAGACAGAAGGTTCGGGATCCGGTTGTACTAGCA
                      ____________________________________________________________
consensus CATGGTCGGCATATGAAGGGCTTTGACAGACAGAAGGTTCGGGATCCGGTTGTACTAGCA
 
. : . : . : . : . : . :
rJMFF040I09+ GAGGAAGAAGCTTTGGAGCCACTTCCTCTAGTAGAAGAGGAACAAGACAAAGATGAGGGC
                      ____________________________________________________________
consensus GAGGAAGAAGCTTTGGAGCCACTTCCTCTAGTAGAAGAGGAACAAGACAAAGATGAGGGC
 
. : . : . : . : . : . :
rJMFF040I09+ TTCATTGATGAGGTTGTCCGGAAAAAGTACTTCGACATGCCACCTTTGACGGTTGCTGAA
                      ____________________________________________________________
consensus TTCATTGATGAGGTTGTCCGGAAAAAGTACTTCGACATGCCACCTTTGACGGTTGCTGAA
 
. : . : . : . : . : . :
rJMFF040I09+ GCAATCGAGCAGCTAGAGAATGTGGATCATGACTTCTATGGCTTTAGGAATGAGGAAACC
                      ____________________________________________________________
consensus GCAATCGAGCAGCTAGAGAATGTGGATCATGACTTCTATGGCTTTAGGAATGAGGAAACC
 
. : . : . : . : . : . :
rJMFF040I09+ GGGGAGATTAACATTGTCTACAGAAGACGAGCCGGGGGTTATGGCCTTATTATTCCAAAG
                      ____________________________________________________________
consensus GGGGAGATTAACATTGTCTACAGAAGACGAGCCGGGGGTTATGGCCTTATTATTCCAAAG
 
. : . : . : . : . : . :
rJMFF040I09+ GGAAATGGGAAAGTTGAGAAGTTGGAGCCTATTGAGGCCGAGCCAATCAGAGAACCATCC
                      ____________________________________________________________
consensus GGAAATGGGAAAGTTGAGAAGTTGGAGCCTATTGAGGCCGAGCCAATCAGAGAACCATCC
 
. : . : . : . : . : . :
rJMFF040I09+ CGCGCTTAGCCAGATGGATTTGGTGAGCAATGAGATAACAAATGCATAATGTGTTTGCTG
                      ____________________________________________________________
consensus CGCGCTTAGCCAGATGGATTTGGTGAGCAATGAGATAACAAATGCATAATGTGTTTGCTG
 
. : . : . : . : . : . :
rJMFF040I09+ TATATTTGATCGTTTAACAATAATATGTTTCAATCACACTGATGGATCCACGACTTCTAA
                      ____________________________________________________________
consensus TATATTTGATCGTTTAACAATAATATGTTTCAATCACACTGATGGATCCACGACTTCTAA
 
. : . : . : . : . : . :
rJMFF040I09+ TCGTTCGTTGGTTGATCCACCACGAGTTAATATCGAATAAGGAGTGGTTTTAGTAAGAAT
                      ____________________________________________________________
consensus TCGTTCGTTGGTTGATCCACCACGAGTTAATATCGAATAAGGAGTGGTTTTAGTAAGAAT