Previous Contig 010072:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040G12Sequence554010072 (2)gb:AC109596_17387382e-48Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1593_C11, complete s762010072 (2)gb:AP003218_18254252e-62Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF040G12- AATTTCAAAGCGGACACAGGCGA
                      ____________________________________________________________
consensus AATTTCAAAGCGGACACAGGCGA
 
. : . : . : . : . : . :
JMFF040G12- GACCGAAAAGACTGAAATATCCCCTGTTTCATCTCATCTCTTCCCATGGCCGATCACGCC
                      ____________________________________________________________
consensus GACCGAAAAGACTGAAATATCCCCTGTTTCATCTCATCTCTTCCCATGGCCGATCACGCC
 
. : . : . : . : . : . :
JMFF040G12- GGAGACCACGATTCGCTTGCTGAGACGGTGATGGAAAAGATCAGCGACAAGTTGCAAGGC
                      ____________________________________________________________
consensus GGAGACCACGATTCGCTTGCTGAGACGGTGATGGAAAAGATCAGCGACAAGTTGCAAGGC
 
. : . : . : . : . : . :
JMFF040G12- CACGATTCCTCGTCTTCCGATTCCGAGGACGATCATGCCGACAAGCCATCTGCCGACGCT
                      ____________________________________________________________
consensus CACGATTCCTCGTCTTCCGATTCCGAGGACGATCATGCCGACAAGCCATCTGCCGACGCT
 
. : . : . : . : . : . :
JMFF040G12- GTTAAGGCCAAGATCTATCGCCTCTTCGGCCGCGAGAGACACGTGCACAAGGTCTTAGGC
                      ____________________________________________________________
consensus GTTAAGGCCAAGATCTATCGCCTCTTCGGCCGCGAGAGACACGTGCACAAGGTCTTAGGC
 
. : . : . : . : . : . :
JMFF040G12- GGAGGAAAACCTGCTGATATTTTCCTGTGGAGGGACAAGAAAGTTTCTGGTGCTGTCGTT
                      ____________________________________________________________
consensus GGAGGAAAACCTGCTGATATTTTCCTGTGGAGGGACAAGAAAGTTTCTGGTGCTGTCGTT
 
. : . : . : . : . : . :
JMFF040G12- GGTTTTGCCACTACTATCTGGGTGCTTTTTGAATTGATGGAATACCACTTACTCACTCTA
rJMFF040G12+ TGGGTGCTTTTTGAATTGATGGAATACCACTTACTCACTCTA
                      ____________________________________________________________
consensus GGTTTTGCCACTACTATCTGGGTGCTTTTTGAATTGATGGAATACCACTTACTCACTCTA
 
. : . : . : . : . : . :
JMFF040G12- GTATGCCACATTTTGATTCTTGCTCTCGCAATATCATTCCTATGGTCAAATGCATCCACA
rJMFF040G12+ GTATGCCACATTTTGATTCTTGCTCTCGCAATATCATTCCTATGGTCAAATGCATCCACA
                      ____________________________________________________________
consensus GTATGCCACATTTTGATTCTTGCTCTCGCAATATCATTCCTATGGTCAAATGCATCCACA
 
. : . : . : . : . : . :
JMFF040G12- TTCATCAACAAATCCCCACCTCAAATCCCATCCGTCATCCTTCCTCAGGATACTGTCCTT
rJMFF040G12+ TTCATCAACAAATCCCCACCTCAAATCCCATCCGTCATCCTTCCTCAGGATACTGTCCTT
                      ____________________________________________________________
consensus TTCATCAACAAATCCCCACCTCAAATCCCATCCGTCATCCTTCCTCAGGATACTGTCCTT
 
. : . : . : . : . : . :
JMFF040G12- AATGTTGCTTCTGCATTGAGAATTGAAATCAATAGAACTCTTGCTGTGCTC
rJMFF040G12+ AATGTTGCTTCTGCATTGAGAATTGAAATCAATAGAACTCTTGCTGTGCTCCGAGAAATT
                      ____________________________________________________________
consensus AATGTTGCTTCTGCATTGAGAATTGAAATCAATAGAACTCTTGCTGTGCTCCGAGAAATT
 
. : . : . : . : . : . :
rJMFF040G12+ GCATCTGGGAAAGATGTGAAGAAATTTCTTGCTGTAATTGCTGGCTTGTGGGTTTTGTCA
                      ____________________________________________________________
consensus GCATCTGGGAAAGATGTGAAGAAATTTCTTGCTGTAATTGCTGGCTTGTGGGTTTTGTCA
 
. : . : . : . : . : . :
rJMFF040G12+ GTCATGGGGAATAGTTTCAACTTCCTCACATTGTTTTACCTGATTGTTGTGCTGCTGCAC
                      ____________________________________________________________
consensus GTCATGGGGAATAGTTTCAACTTCCTCACATTGTTTTACCTGATTGTTGTGCTGCTGCAC
 
. : . : . : . : . : . :
rJMFF040G12+ ACAGTTCCCATGCTGTATGAGAAATACGAAGATCAAGTCGATGCTTTTGCTGAGAAGGCC
                      ____________________________________________________________
consensus ACAGTTCCCATGCTGTATGAGAAATACGAAGATCAAGTCGATGCTTTTGCTGAGAAGGCC
 
. : . : . : . : . : . :
rJMFF040G12+ GAGGCAGAGATCATGAAGCAATATGCGGTGCTTAATGAAAAGTATCTGAGTAAAATTCCA
                      ____________________________________________________________
consensus GAGGCAGAGATCATGAAGCAATATGCGGTGCTTAATGAAAAGTATCTGAGTAAAATTCCA
 
. : . : . : . : . : . :
rJMFF040G12+ AAAGGCCCCCTGAAGGACAAGAAGCTCGCCTAATAAGAGAGATGGTGTTTCACATTGAAG
                      ____________________________________________________________
consensus AAAGGCCCCCTGAAGGACAAGAAGCTCGCCTAATAAGAGAGATGGTGTTTCACATTGAAG
 
. : . : . : . : . : . :
rJMFF040G12+ TTTCTTTCAAGATGTTGTGAGGATCTACTGTTTTAGAGCCGTCGTTTTATGGCTTTGTTT
                      ____________________________________________________________
consensus TTTCTTTCAAGATGTTGTGAGGATCTACTGTTTTAGAGCCGTCGTTTTATGGCTTTGTTT
 
. : . : . : . : . : . :
rJMFF040G12+ TGACTTGTAATGGTCTATAAGCAAGCTAAAAGTACTCTCATTTTATAAGTTTAGTTTTTC
                      ____________________________________________________________
consensus TGACTTGTAATGGTCTATAAGCAAGCTAAAAGTACTCTCATTTTATAAGTTTAGTTTTTC
 
. : . : . : . : . : . :
rJMFF040G12+ TTTGGAGATTTGTTTTGCCATGTTCTTGACAGCTTCATGGCTCTCAACAGCAGTGTATTC
                      ____________________________________________________________
consensus TTTGGAGATTTGTTTTGCCATGTTCTTGACAGCTTCATGGCTCTCAACAGCAGTGTATTC
 
. : . : . : . : . : . :
rJMFF040G12+ AGAGAGCAAGGTTCATCTTTTCCTCTGAAAATTAGTGCCTACGGTAGGTTTTGCTTGCAA
                      ____________________________________________________________
consensus AGAGAGCAAGGTTCATCTTTTCCTCTGAAAATTAGTGCCTACGGTAGGTTTTGCTTGCAA