Previous Contig 010070:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016O01Sequence605000863 (5)704010070 (2)gb:AMO440730_18192464e-13Antirrhinum mollissimum partial mRNA for S-ribonuclease (s1RNase gene).
JMFF040E15Sequence551000863 (5)717010070 (2)gb:AMO440730_18192462e-12Antirrhinum mollissimum partial mRNA for S-ribonuclease (s1RNase gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF016O01+ CTGGGTATCATTGTACTGGTGACCGCGAGCAATTCCACCATTTTGTAAAACACGCGCGA
rJMFF040E15+ GGGTATCATTGTACTGGTGACCGCGAGCAATTCCACCATTTTGTAAAACACGCGCGA
                      ____________________________________________________________
consensus CTGGGTATCATTGTACTGGTGACCGCGAGCAATTCCACCATTTTGTAAAACACGCGCGA
 
. : . : . : . : . : . :
rJMFF016O01+ TATTGTTCCTGTGCAACAGATCCAGTGCTTTAGCGAAGTATTGAGTTTGATTGAAGAGAG
rJMFF040E15+ TATTGTTCCTGTGCAACAGATCCAGTGCTTTAGCGAAGTATTGAGTTTGATTGAAGAGAG
                      ____________________________________________________________
consensus TATTGTTCCTGTGCAACAGATCCAGTGCTTTAGCGAAGTATTGAGTTTGATTGAAGAGAG
 
. : . : . : . : . : . :
rJMFF016O01+ TAAAGGAAGCCCTGCCATGGTTATTCCACTCGTGTGCCCAAAAACCATCATCAGGCCCAA
rJMFF040E15+ TAAAGGAAGCCCTGCCATGGTTATTCCACTCGTGTGCCCAAAAACCATCATCAGGCCCAA
                      ____________________________________________________________
consensus TAAAGGAAGCCCTGCCATGGTTATTCCACTCGTGTGCCCAAAAACCATCATCAGGCCCAA
 
. : . : . : . : . : . :
rJMFF016O01+ GCGTTGCTCCGGAGTTGACAAATGGCCATAGACCATGGATGGTGAAATCGGATTTCACCT
rJMFF040E15+ GCGTTGCTCCGGAGTTGACAAATGGCCATAGACCATGGATGGTGAAATCGGATTTCACCT
                      ____________________________________________________________
consensus GCGTTGCTCCGGAGTTGACAAATGGCCATAGACCATGGATGGTGAAATCGGATTTCACCT
 
. : . : . : . : . : . :
rJMFF016O01+ TACTCANTACGCAACGGGTACCAAGGGAAGCACAATAGCCTGGGGGCCATATGAGTGCCA
rJMFF040E15+ TACTCACTACGCAACGGGTACCAAGGGAAGCACAATAGCCTGGGGGCCATATGAGTGCCA
                      ____________________________________________________________
consensus TACTCACTACGCAACGGGTACCAAGGGAAGCACAATAGCCTGGGGGCCATATGAGTGCCA
 
. : . : . : . : . : . :
rJMFF016O01+ AACCAAAGCCATCCCATTGGTTTTTTTGGGTGGAATGTGAAGTGTTAGAAGCACATGTTA
rJMFF040E15+ AACCAAAGCCATCCCATTGGTTTTTTTGGGTGGAATGTGAAGTGTTAGAAGCACATGTTA
                      ____________________________________________________________
consensus AACCAAAGCCATCCCATTGGTTTTTTTGGGTGGAATGTGAAGTGTTAGAAGCACATGTTA
 
. : . : . : . : . : . :
rJMFF016O01+ TTCATCCATTGACTGATCCTATACTCAGCTCATGATCGGGAATGAAGTGACCATAATGAA
rJMFF040E15+ TTCATCCATTGACTGATCCTATACTCAGCTCATGATCGGGAATGAAGTGACCATAATGAA
                      ____________________________________________________________
consensus TTCATCCATTGACTGATCCTATACTCAGCTCATGATCGGGAATGAAGTGACCATAATGAA
 
. : . : . : . : . : . :
rJMFF016O01+ AGCTCGTTACGTTTTTGGAGCTGACTGACTAGTGACTAGTTAGTATGCAACAAGACTGTA
rJMFF040E15+ AGCTCGTTACGTTTTTGGAGCTGACTGACTAGTGACTAGTTAGTATGCAACAAGACTGTA
                      ____________________________________________________________
consensus AGCTCGTTACGTTTTTGGAGCTGACTGACTAGTGACTAGTTAGTATGCAACAAGACTGTA
 
. : . : . : . : . : . :
rJMFF016O01+ CCCCTTGGCTGGCTCGCATAGTACTAACTACTAAATTCAAAGCCCGGTTAAATTCAAAGC
rJMFF040E15+ CCCCTTGGCTGGCTCGCATAGTACTAACTACTAAATTCAAAGCCCGGTTAAATTCAAAGC
                      ____________________________________________________________
consensus CCCCTTGGCTGGCTCGCATAGTACTAACTACTAAATTCAAAGCCCGGTTAAATTCAAAGC
 
. : . : . : . : . : . :
rJMFF016O01+ CCTTAGCTTGCCCTCCGGCCTGCTCCTATTACTGCATTCAATTGAGACATTAAAATTAGT
rJMFF040E15+ CCTTAGCTTGCCCTCCGGCCTGCTCCTATTACTGCATTCAATTGAGACATTAAAATTAGT
                      ____________________________________________________________
consensus CCTTAGCTTGCCCTCCGGCCTGCTCCTATTACTGCATTCAATTGAGACATTAAAATTAGT
 
. : . : . : . : . : . :
rJMFF016O01+ TTGACAGTTGGGATGGGAAACTTTTGCCAAACTTGTCCTCCTGCAAATTGAGGTTGCATG
rJMFF040E15+ TTGACAGTTGGGATGGGAAACTTTTGCCAAACTTGTCCTCCTGCAAATTGAGGTTGCATG
                      ____________________________________________________________
consensus TTGACAGTTGGGATGGGAAACTTTTGCCAAACTTGTCCTCCTGCAAATTGAGGTTGCATG
 
. : . : . : . : . : . :
rJMFF016O01+ TCAGAAACTTTGCCAAACTTTTCCGTATTTGTACTATTAATTATT
rJMFF040E15+ TCAGAAACTTTGCCAAACTTTTCCGTATTTGTACTATTAATTATTGTAGTTTAATTTTAA
                      ____________________________________________________________
consensus TCAGAAACTTTGCCAAACTTTTCCGTATTTGTACTATTAATTATTGTAGTTTAATTTTAA