Previous Contig 010064:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040C05Sequence424010064 (5)pir|T08930|T089302e-10hypothetical protein T15N24.90 - Arabidopsis thaliana>gb:ATCHRIV65_1546545 Arabi507010064 (5)pir|T08930|T089303e-10hypothetical protein T15N24.90 - Arabidopsis thaliana>gb:ATCHRIV65_1546545 Arabi
JMSF010I24Sequence250010064 (5)pir|T08930|T089300.024hypothetical protein T15N24.90 - Arabidopsis thaliana>gb:ATCHRIV65_1546545 Arabi731012354 (4)gb:PCU58540_16994833e-38Petroselinum crispum DNA-binding protein WRKY2 mRNA, partial cds.
JMSF011O02Sequence317010064 (5)pir|T08930|T089308e-14hypothetical protein T15N24.90 - Arabidopsis thaliana>gb:ATCHRIV65_1546545 Arabi705012354 (4)gb:PCU58540_16994832e-25Petroselinum crispum DNA-binding protein WRKY2 mRNA, partial cds.
JMSF019G14Sequence595010064 (5)sp|Q93WV0|WR20_ARATH8e-24Probable WRKY transcription factor 20 (WRKY DNA-binding protein 20).>gb:AY568651733012354 (4)gb:PCU58540_16994831e-33Petroselinum crispum DNA-binding protein WRKY2 mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF019G14+ GATGTAGGAATTATTGAAGACTCA
                      ____________________________________________________________
consensus GATGTAGGAATTATTGAAGACTCA
 
. : . : . : . : . : . :
JMSF019G14+ AGCAAAGATGATGGTGCTAATGACTGAGGAAGGCATTGATCTTGAGATTGCTTCAGAGGT
                      ____________________________________________________________
consensus AGCAAAGATGATGGTGCTAATGACTGAGGAAGGCATTGATCTTGAGATTGCTTCAGAGGT
 
. : . : . : . : . : . :
JMSF019G14+ TCATTTTGCTTGGGACCTATTGATGACGATTCTGATGTAGAGTAAGAACCAACAGGGAAT
                      ____________________________________________________________
consensus TCATTTTGCTTGGGACCTATTGATGACGATTCTGATGTAGAGTAAGAACCAACAGGGAAT
 
. : . : . : . : . : . :
JMSF019G14+ TCAAACTCAAAGTTGTTGGATTTACTTTCAATATAAATGTTGCTTCTGGGAAATGAAAAT
                      ____________________________________________________________
consensus TCAAACTCAAAGTTGTTGGATTTACTTTCAATATAAATGTTGCTTCTGGGAAATGAAAAT
 
. : . : . : . : . : . :
JMSF019G14+ CCACCAGTGCTGCCAAAGCCTTGCATTGTTTGAAGTTTCGAGAAGGAGCCTGTGGTTGGA
                      ____________________________________________________________
consensus CCACCAGTGCTGCCAAAGCCTTGCATTGTTTGAAGTTTCGAGAAGGAGCCTGTGGTTGGA
 
. : . : . : . : . : . :
JMFF040C05+ CTTTGACGTTAGAGAGAAGAACAGGAGATTCGAGAAACGACGTCGGACTG
JMSF019G14+ GAGGGCTCTGCTTTGACGTTAGAGAGAAGAACAGGAGATTCGAGAAACGACGTCGGACTG
JMSF011O02+ GACGTTAGAGAGAAGAACAGGAGATTCGAGAAACGACGTCGGACTG
rJMFF040C05- CTTTGACGTTAGAGAGAAGAACAGGAGATTCGAGAAACGACGTCGGACTG
                      ____________________________________________________________
consensus GAGGGCTCTGCTTTGACGTTAGAGAGAAGAACAGGAGATTCGAGAAACGACGTCGGACTG
 
. : . : . : . : . : . :
JMFF040C05+ AGGCCAGGAGGGATGGTAATACAGGCAGACCTAGAGATCGGGAGCTTGGCCGGAGACATG
JMSF019G14+ AGGCCAGGAGGGATGGTAATACAGGCAGACCTAGAGATCGGGAGCTTGGCCGGAGACATG
JMSF011O02+ AGGCCAGGAGGGATGGTAATACAGGCAGACCTAGAGATCGGGAGCTTGGCCGGAGACATG
JMSF010I24+ CAGGCAGACCTAGAGATCGGGAGCTTGGCCGGAGACATG
rJMFF040C05- AGGCCAGGAGGGATGGTAATACAGGCAGACCTAGAGATCGGGAGCTTGGCCGGAGACATG
                      ____________________________________________________________
consensus AGGCCAGGAGGGATGGTAATACAGGCAGACCTAGAGATCGGGAGCTTGGCCGGAGACATG
 
. : . : . : . : . : . :
JMFF040C05+ AGCTTGTACTTAGCTCCACCGTTAGGTCCGGCGGCGTTCCTGGAGAAGACGGCGGCATCA
JMSF019G14+ AGCTTGTACTTAGCTCCACCGTTAGGTCCGGCGGCGTTCCTGGAGAAGACGGCGGCATCA
JMSF011O02+ AGCTTGTACTTAGCTCCACCGTTAGGTCCGGCGGCGTTCCTGGAGAAGACGGCGGCATCA
JMSF010I24+ AGCTTGTACTTAGCTCCACCGTTAGGTCCGGCGGCGTTCCTGGAGAAGACGGCGGCATCA
rJMFF040C05- AGCTTGTACTTAGCTCCACCGTTAGGTCCGGCGGCGTTCCTGGAGAAGACGGCGGCATCA
                      ____________________________________________________________
consensus AGCTTGTACTTAGCTCCACCGTTAGGTCCGGCGGCGTTCCTGGAGAAGACGGCGGCATCA
 
. : . : . : . : . : . :
JMFF040C05+ GAAGCGTCGGAGCTGCCGTCATCGACGTGGTCGGGAGCGTGAGCGGCGTCGTCGGCGCG
JMSF019G14+ GAAGCGTCGGAGCTGCCGTCATCGACGTGGTCGGGAGCGTGAGCGGCGTCGTCGGCGCGT
JMSF011O02+ GAAGCGTCGGAGCTGCCGTCATCGACGTGGTCGGGAGCGTGAGCGGCGTCGTCGGCGCGT
JMSF010I24+ GAAGCGTCGGAGCTGCCGTCATCGACGTGGTCGGGAGCGTGAGCGACGTCGTCGGCGCGT
rJMFF040C05- GAAGCGTCGGAGCTGCCGTCATCGACGTGGTCGGGAGCGTGAGCGGCGTCGTCGGCGCGT
                      ____________________________________________________________
consensus GAAGCGTCGGAGCTGCCGTCATCGACGTGGTCGGGAGCGTGAGCGGCGTCGTCGGCGCGT
 
. : . : . : . : . : . :
JMSF019G14+ GGAGCAGCGAGGTGTTGCTGAGAGTGGGAGTTAGAGTAGAGAGAGTGTGAGTGAGAGTCC
JMSF011O02+ GGAGCAGCGAGGTGTTGCTGAGAGTGGGAGTTAGAGTAGAGAGAGTGTGAGTGAGAGTCC
JMSF010I24+ GGAGCAGCGAGGTGTTGCTGAGAGTGGGAGTTAGAGTAGAGAGAGTGTGAGTGAGAGTCC
rJMFF040C05- GGAGCAGCGAGGTGTTGCTGAGAGTGGGAGTTAGAGTAGAGAGAGTGTGAGTGAGAGTCC
                      ____________________________________________________________
consensus GGAGCAGCGAGGTGTTGCTGAGAGTGGGAGTTAGAGTAGAGAGAGTGTGAGTGAGAGTCC
 
. : . : . : . : . : . :
JMSF019G14+ TCCATTGAGGATTCAGGCAAGAAAGAGGTTC
JMSF011O02+ TCCATTGAGGATTCAGGCAAGAAAGAGGTTC
JMSF010I24+ TCCATTGAGGATTCAGGCAAGAAAGAGGTTC
rJMFF040C05- TCCATTGAGGATTCAGGCAAGAAAGAGGTTCTCAGTTATCGCTGTTCCAGACAGCGATGA
                      ____________________________________________________________
consensus TCCATTGAGGATTCAGGCAAGAAAGAGGTTCTCAGTTATCGCTGTTCCAGACAGCGATGA